Информация

Получаване на PCR амплификация при отгряване по-високо от Tm!

Получаване на PCR амплификация при отгряване по-високо от Tm!


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Усилвам ген, където в градиентен pcr получавам амплификация при температура на отгряване с около 5 градуса (67) по-висока от Tm (62.5)? Какво не е наред тук? Освен това получавам много силна интензивна лента с грешен размер за всички температури, изпробвани под Tm. Моля, помогнете


Много често се получава отгряване при по-високо от предвиденото Tm. Ако това е проблем във вашия случай, особено ако получавате неправилно отгряване при по-ниски температури, помислете за използването на PCR при докосване, за да намерите оптимална температура. Или, прагматично, ако имате някаква гъвкавост в дизайна на грунд, просто поръчайте комплект грундове и ги опитайте всички. Грундовете днес са евтини и често ще намерите комплект, който работи дори там, където програмите за проектиране твърдят, че няма да го направят.


Tm на праймерите няма да каже много за PCR условията. Когато получите неспецифични ленти, си струва да опитате по-висока температура.

Вашият опит за температура вече е близо до температурата за удължаване, така че совалковият PCR е наличен. Shuttle PCR има само 2 стъпки: 94 до 96 градуса за топене на ДНК и 68 до 74 градуса за отгряване и удължаване заедно.

Може да искате да добавите DMSO или betain. Те биха могли да помогнат за намаляване на неправилното отгряване. Ако неспецифичните ленти са по-малки и по-дълги от лентите, които очаквате, по-дългото и по-краткото време за удължаване може да ви даде по-добри резултати, съответно.

И не забравяйте, че дизайнът на грунда също е важен. Проверете дали имате повтарящи се последователности във вашия шаблон и избягвайте да проектирате праймери от такива последователности.


По отношение на по-висока температура на отгряване от Tm, често използвам T7 грунд, от който Tm е 48,3 градуса. Грундът работи добре при 55 градуса температура на отгряване. Обикновено праймерите са излишни в PCR реакционните епруветки, изтласквайки химичното равновесие към отгряване. Това е, което предполагам.


ТМ на грунда също се влияе от концентрацията на сол във вашата смес. Опитвате ли PCR градиента? Или пробвате да изчислите Tm и да вземете предвид концентрацията на сол. http://www.biophp.org/minitools/melting_temperature/demo.php


PCR при тъчдаун: Пример и някои съвети

Когато за първи път чух за PCR за кацане, се сетих за кацащ самолет, което, както се оказа, не е лош начин да се мисли за това.

Но въпреки податливостта му към аналогии и ужасни каламбури (виж заглавието), PCR с тъч-даун (TD-PCR), много полезна техника за подобряване на специфичността на амплификацията на PCR, е по-сложна, отколкото може да изглежда на пръв поглед. Така че в тази статия ще дам пример за PCR (TD-PCR) и някои съвети и препратки за усъвършенстването му.


QPCR и RT-qPCR

Количествен PCR крайна точка

PCR и RT-PCR обикновено се използват в качествен формат за оценка на биологични проби. Въпреки това, голямо разнообразие от приложения, като определяне на вирусен товар, измерване на реакциите към терапевтични агенти и характеризиране на генната експресия, биха били подобрени чрез количествено определяне на целевото изобилие. Теоретично това трябва да бъде лесно за постигане, като се има предвид експоненциалният характер на PCR, тъй като съществува линейна връзка между броя на циклите на амплификация и логаритъма на броя на молекулите. На практика обаче ефективността на амплификацията е намалена поради замърсители (инхибитори), конкурентни реакции, изчерпване на субстрата, инактивиране на полимераза и целево повторно отгряване. С увеличаване на броя на циклите ефективността на усилване намалява, което в крайна сметка води до ефект на плато.

Обикновено количественият PCR изисква измерванията да се правят преди фазата на плато, така че връзката между броя на циклите и молекулите да е относително линейна. Тази точка трябва да бъде определена емпирично за различни реакции поради многобройните фактори, които могат да повлияят на ефективността на усилване. Тъй като измерването се извършва преди реакционното плато, количествената PCR използва по-малко цикли на амплификация от основната PCR. Това може да причини проблеми при откриването на крайния продукт, тъй като има по-малко продукти за откриване.

За да се следи ефективността на амплификацията, много приложения са проектирани да включват вътрешен стандарт в PCR. Един такъв подход включва втора праймерна двойка, която е специфична за ген на &ldquohousekeeping&rdquo (т.е. ген, който има постоянни нива на експресия сред сравняваните проби) в реакцията (Gaudette and Crain, 1991 Murphy et al. 1990 г.). Амплификацията на домакинските гени потвърждава, че целевата нуклеинова киселина и компонентите на реакцията са с приемливо качество, но не отчита разликите в ефективността на амплификация поради разликите в размера на продукта или ефективността на отгряване на праймера между вътрешния стандарт и целта, която се определя количествено.

Концепцията за конкурентен PCR&mdasha вариация на количествен PCR&mdashi е отговор на това ограничение. При конкурентен PCR, известно количество от контролен шаблон се добавя към реакцията. Този шаблон се амплифицира с помощта на същата двойка праймери като експерименталната целева молекула, но дава различим продукт (например различен размер, рестрикционен модел на усвояване и т.н.). Количествата на контролния и тестовия продукт се сравняват след амплификация. Докато тези подходи контролират качеството на целевата нуклеинова киселина, буферните компоненти и ефективността на отгряване на праймера, те имат свои собствени ограничения (Siebert and Larrick, 1993 McCulloch et al. 1995), включително факта, че много от тях зависят от крайния анализ чрез електрофореза.

Съществуват множество флуоресцентни и твърдофазни анализи за измерване на количеството на амплифицирания продукт, генериран във всяка реакция, но те често не успяват да разграничат амплифицираната ДНК от интерес от неспецифичните продукти на амплификация. Някои от тези анализи разчитат на техники за блотиране, които въвеждат друга променлива поради ефективността на трансфера на нуклеинова киселина, докато други анализи са разработени, за да елиминират необходимостта от гел електрофореза, но същевременно осигуряват необходимата специфичност. PCR в реално време, който предоставя възможност за преглед на резултатите от всеки цикъл на усилване, е популярен начин за преодоляване на необходимостта от анализ чрез електрофореза.

Количествен PCR в реално време

Използването на флуоресцентно белязани олигонуклеотидни сонди или праймери или флуоресцентни ДНК-свързващи багрила за откриване и количествено определяне на PCR продукт позволява количествена PCR да се извърши в реално време. Специално проектираните инструменти изпълняват както термични цикли за усилване на целта, така и откриване на флуоресценция за наблюдение на натрупването на PCR продукт. ДНК-свързващите багрила са лесни за използване, но не правят разлика между специфични и неспецифични PCR продукти и не са благоприятни за мултиплексни реакции. Флуоресцентно белязаните сонди за нуклеинови киселини имат предимството, че реагират само със специфични PCR продукти, но могат да бъдат скъпи и трудни за проектиране. Някои qPCR технологии използват флуоресцентно белязани PCR праймери вместо сонди.

Използването на флуоресцентни ДНК-свързващи багрила е един от най-лесните qPCR подходи. Багрилото просто се добавя към реакцията и флуоресценцията се измерва при всеки PCR цикъл. Тъй като флуоресценцията на тези багрила се увеличава драстично в присъствието на двойно-верижна ДНК, синтезът на ДНК може да се наблюдава като увеличаване на флуоресцентния сигнал. Въпреки това, често трябва да се извършва предварителна работа, за да се гарантира, че PCR условията дават само специфичен продукт. В следващите реакции специфичното усилване може да се провери чрез анализ на кривата на стопилката. Термичните криви на стопилката се генерират, като се позволи на целия продукт да образува двуверижна ДНК при по-ниска температура (приблизително 60°C) и бавно повишаване на температурата до нива на денатуриране (приблизително 95°C). Дължината и последователността на продукта влияят на температурата на топене (Tm), така че кривата на топене се използва за характеризиране на хомогенността на ампликона. Неспецифичното усилване може да бъде идентифицирано чрез широки пикове в кривата на стопилка или пикове с неочаквани стойности на Tm. Чрез разграничаване на специфични и неспецифични продукти на амплификация, кривата на стопяване добавя аспект на контрол на качеството по време на рутинна употреба. Генерирането на криви на стопилка не е възможно с анализи, които разчитат на 5&prime&rarr3&prime екзонуклеазната активност на Taq ДНК полимераза, като например базираната на сонда технология TaqMan®.

Някои qPCR стратегии използват допълнителни сонди за нуклеинови киселини за количествено определяне на ДНК целта. Тези сонди също могат да се използват за откриване на единични нуклеотидни полиморфизми (Lee et al. 1993 Бернар et al. 1998 г.). Има няколко общи категории PCR сонди в реално време, включително хидролиза, фиби и прости хибридизационни сонди. Тези сонди съдържат комплементарна последователност, която позволява на сондата да се отгрява към натрупващия се PCR продукт, но сондите могат да се различават по броя и местоположението на флуоресцентните репортери.

Хидролизните сонди са маркирани с флуор в 5&основния край и гасител в 3&основния край и тъй като двата репортера са в непосредствена близост, флуоресцентният сигнал се потушава. По време на етапа на отгряване, сондата хибридизира с PCR продукта, генериран в предишни цикли на амплификация. Полученият хибрид сонда:целеви е субстрат за 5&prime&rarr3&prime екзонуклеазната активност на ДНК полимеразата, която разгражда отгряваната сонда и освобождава флуора (Холандия et al. 1991). Флуорът се освобождава от ефектите на поглъщащия енергия гасител и напредъкът на реакцията и натрупването на PCR продукта се следи от полученото увеличаване на флуоресценцията. При този подход трябва да се извършат предварителни експерименти преди количествените експерименти, за да се покаже, че генерираният сигнал е пропорционален на количеството на желания PCR продукт и че не настъпва неспецифично усилване.

Сондите за фиби, известни също като молекулярни маяци, съдържат обърнати повторения, разделени от последователност, комплементарна на целевата ДНК. Повтарящото се отгряване за образуване на структура на фиби, където флуорът в 5&prime-края и гасителят в 3&prime-края са в непосредствена близост, което води до малък флуоресцентен сигнал. Сондата за фиби е проектирана така, че сондата да се свързва преференциално с целевата ДНК, вместо да запазва структурата на фиби. С напредването на реакцията увеличаващите се количества от сондата се отгряват към натрупващия се PCR продукт и в резултат на това флуорът и гасителят се разделят физически. Флуорът вече не се гаси и нивото на флуоресценция се увеличава. Едно от предимствата на тази техника е, че е по-малко вероятно сондите за фиби да не съвпадат, отколкото сондите за хидролиза (Tyagi et al. 1998 г.). Въпреки това трябва да се извършат предварителни експерименти, за да се покаже, че сигналът е специфичен за желания PCR продукт и че не настъпва неспецифично усилване.

Използването на прости хибридизационни сонди включва две белязани сонди или, алтернативно, една белязана сонда и белязан PCR праймер. При първия подход енергията, излъчвана от флуора на една сонда, се абсорбира от флуор на втората сонда, която хибридизира наблизо. При втория подход, излъчваната енергия се абсорбира от втори флуор, който е включен в PCR продукта като част от праймера. И двата подхода водят до повишена флуоресценция на енергийния акцептор и намалена флуоресценция на енергийния донор. Използването на хибридизационни сонди може да се опрости още повече, така че да е необходима само една маркирана сонда. При този подход се използва гасене на флуора чрез деоксигуанозин, за да се постигне промяна във флуоресценцията (Crockett and Wittwer, 2001 Kurata et al. 2001 г.). Маркираната сонда се отгрява, така че флуорът да е в непосредствена близост до G остатъци в рамките на целевата последователност и с увеличаване на отгряването на сондата, флуоресценцията намалява поради гасене на деоксигуанозин. С този подход местоположението на сондата е ограничено, тъй като сондата трябва да се хибридизира, така че флуоресцентното багрило да е много близо до G остатък. Предимството на простите хибридизационни сонди е тяхната способност да се мултиплексират по-лесно от хидролизата и сондите с фиби чрез използването на различно оцветени флуори и сонди с различни температури на топене (прегледани в Wittwer et al. 2001).

Някои qPCR стратегии използват допълнителни сонди за нуклеинови киселини за количествено определяне на ДНК целта. Тези сонди също могат да се използват за откриване на единични нуклеотидни полиморфизми (Lee et al . 1993 Бернар et al . 1998 г.). Има няколко общи категории PCR сонди в реално време, включително хидролиза, фиби и прости хибридизационни сонди. Тези сонди съдържат допълнителна последователност, която позволява на сондата да се отгрява към натрупващия се PCR продукт, но сондите могат да се различават по броя и местоположението на флуоресцентните репортери.

QPCR продукти и ресурси

Налични са комплекти GoTaq® qPCR и RT-qPCR за PCR подходи в реално време на базата на багрило или на сонда. Системите GoTaq qPCR съдържат BRYT Green Dye, който осигурява максимална ефективност на усилване и по-голяма флуоресценция от SYBR Green.

GoTaq® Probe Systems са готови за използване основни смеси, които опростяват сглобяването на реакцията за откриване на базата на хидролизна сонда.


Защо праймерите не трябва да имат разлика в Tm по-голяма от 5°C? - (29 септември 2011 г.)

Tm за моите предни грундове е 73C, а за обратния е 53C.

Грунд F
TGCAGGCGCCCCGAGTGCTGC

Грунд Р
CGTCACTAGTGTCGTCTACTA

Освен факта, че Tm 73C е дори по-висока от температурата на удължаване (68C за pfx ДНК полимераза), Tm калкулаторите ми казват, че разликата между Tm температурите е по-голяма от препоръчителните 5C и следователно PCR няма да работи.

Tm ви казва при каква температура ще се стопи половината от вашия праймер (т.е. несвързваща шаблонна ДНК). Ta е избран да бъде по-нисък от Tm, така че повечето от вашите праймери свързват ДНК. Колкото по-ниска се спускате с температурата, шансът ви да се свърже неспецифично (с некомплементарна последователност) нараства шансът ви да се свърже. Така че трябва да изберете правилната температура на отгряване, не толкова висока (без усилване), не толкова ниска (неспецифична).
Ако имате праймери с толкова различен Tm, не можете да имате оптимална температура за свързване на двата праймера.
IMO.

Но има ли шанс да работи?

Винаги има шанс. Те са много начини за изчисляване на Tm и някои от тях се различават много. А реалната ситуация зависи и от шаблона и кой знае какво още.
Но не бих бил прекалено оптимист, 20 градуса. Вашата F праймерна последователност е високо самодопълваща се, така че ще ви трябва по-висока Ta, за да я отпуснете, но по това време вашият R праймер вероятно изобщо няма да свързва ДНК.
Можете да опитате, но ако не работи, вероятно ще бъде по-бързо и по-евтино да проектирате нови грундове.

Разбирам идеята, която Trof се опитва да направи, и съм съгласен, че ако PCR не работи и имате възможност, бих се опитал да преработя различни праймери, които имат по-близки стойности на Tm. Например, можете да свалите последния "GC" от предния си грунд и това ще намали вашия Tm с около 8 градуса. Като се има предвид това, имах ситуации, в които нямах избор да използвам два праймера с много различни стойности на Tm и накарах PCR да работи добре. Винаги трябва да работите в рамките на най-ниския си Tm грунд, което означава, че вероятно ще трябва да използвате температура на отгряване от 50-54 градуса. Освен това открих, че работата с праймери с висок Tm означава, че може да искате да удължите своя етап на денатурация. Повечето полимерази се предлагат с препоръчан времеви диапазон (например 95 градуса за 10-30 s). Ако имам грунд с Tm над 65, обикновено удължавам моята денатурационна стъпка в цикленето до 30 градуса и откривам, че това помага.

Градиентната PCR се провали. Зададох температурите от 40°C до 65°C, но не даде никаква лента. Проведох и 2 стъпка PCR, играх с времето за денатурация, както е препоръчано от allynspear, но също се провали. Мисля, че ще проектирам нови грундове.


Как се изчислява температурата на отгряване за PCR?

Температурата на отгряване (Tа), избран за PCR, разчита директно на дължината и състава на праймерите. Обикновено трябва да използвате температура на отгряване около 5°C под Tм на вашите букви. Оптималната температура на отгряване (Tа Opt) за дадена двойка праймери върху конкретна цел може да се изчисли, както следва: Tа Opt = 0,3 x (Tм грунд) + 0,7 x (Tм на продукта) &ndash 14.9 където Tм на праймера е температурата на топене на по-малко стабилната двойка праймер-шаблон, а Tм на продукта е температурата на топене на PCR продукта [1].

Едно следствие от наличието на Та твърде ниско е, че един или и двата праймера ще се отгряват към последователности, различни от предвидената цел, тъй като вътрешните несъответствия на една база или частичното отгряване могат да бъдат толерирани. Това може да доведе до неспецифична PCR амплификация и следователно ще намали добива на желания продукт. Обратно, когато Та е твърде високата ефективност на реакцията може да бъде намалена, тъй като вероятността от отгряване на праймера се намалява значително. Оптималните температури на отгряване дават най-висок добив на продукта от правилния ампликон.


Високоскоростен qPCR – 5 начина да направите своя qPCR по-бързо

Това не са обичайните съвети като аликвотиране на праймери, използване на определени зони (правило за три стаи) и оборудване за стъпките преди и след амплификация, за да се намали рискът от замърсяване. Така че нека влезем в него!

1. Изберете по-високо съдържание на GC за вашия шаблон – скоростта на qPCR зависи от това

Може да не винаги е възможно, но ако е възможно, изберете ампликони с по-високо съдържание на GC. Установено е, че средната скорост на разширение за гуанин (G) и цитозин (C). 2,8 пъти по-висока отколкото за аденин (А) и тимин (Т) при температури до 75°C. Оптималното съдържание на GC е наоколо 60%. Тук най-високите скорости на удължаване се наблюдават между 70°C и 75°C (при температури под 70°C и над 75°C скоростите на удължаване показват почти линейно намаляване).

За шаблони с ниско съдържание на GC или съдържание на GC, по-голямо от 60%, процентите на разширение намаляват. Тук високото съдържание на GC има по-голямо влияние от ниското съдържание на GC, вероятно поради образуването на вторични структури в областта на разширение.

Въпреки това е от решаващо значение да тествайте различно съдържание на GC за полимераза, която се използва. Нативният и делеционният вариант на Taq полимераза показват повишени скорости на удължаване с увеличаване на съдържанието на GC (до около 80%), докато Pfu полимеразният вариант показва намалени скорости на удължаване с увеличаване на съдържанието на GC при 75°C (Montgomery et al., 2014).

Като цяло си струва да проверите дали по-високото съдържание на GC в ампликона може да намали времето за удължаване на всеки цикъл.

2. Изберете разумно основния микс за вашия qPCR

Що се отнася до скоростта, използването на dUTP като заместител на dTTP в основната смес трябва да се избягва. Включването на урацил (U) е средно 50% по-бавно отколкото на Т при температури до 65°C. Увеличаването на концентрацията на U в основната смес няма положителен ефект върху скоростта на включване, дори я намалява (Montgomery et al., 2014).

Също така, на рН на реакцията влияе силно върху скоростта на удължаване. Въпреки това, идеалният диапазон е тесен и между рН 8,5 и рН 8,7. Под pH 8,5 степента на удължаване намалява значително: около 60% с всяка pH единица. Над идеалния диапазон на pH скоростта на удължаване намалява още по-значително и почти напълно се инхибира при pH 7 (Montgomery et al., 2013).

Други силно въздействащи фактори върху процента на удължаване са магнезиев хлорид (MgCl 2 ) и калиев хлорид (KCL) концентрации. Високите концентрации на MgCl 2 от 3 до 6 mM водят до по-високи скорости на разширение. По-конкретно, 1,5 mM MgCl 2 Установено е, че концентрацията води до приблизително 50 % намаление от скоростта на удължаване в сравнение с концентрация от 5 mM.

Високи концентрации на KCl, въпреки това, силно инхибира полимеразната активност. Наблюдава се повече от 70 % намаление на скоростта на удължаване при концентрация на KCl от 37,5 mM в сравнение с 0 mM. Най-голямата полимеразна активност е установена, когато KCl отсъства или е в най-ниска концентрация (Montgomery et al., 2013 Монтгомъри и Уитуър, 2014).

Когато съдържанието на GC в ампликона е по-високо, добавянето на DMSO при 5% или 7,5% може да подобри усилването чрез намаляване на вторичните структури. Установено е обаче, че използването на 10% DMSO намалява степента на удължаване (Montgomery et al.,2014 Монтгомъри и Уитуър, 2014)!

Поради това е от съществено значение за скоростта на qPCR да се регулира pH и концентрациите на MgCl 2 и KCl в основната смес.

Друг момент, който трябва да вземете предвид, е изборът на подходяща концентрация на багрилото за qPCR реакции. Нековалентните багрила намаляват степента на удължаване и е доказано, че по-ниската концентрация на тези багрила ускорява екстензията. Въпреки това, по-ниските концентрации на багрилото водят до по-ниска сила на сигнала и могат да се използват само ако чувствителността на оптичния сензор на qPCR цикъла е достатъчно голяма (Montgomery and Wittwer, 2014). И така, доказателството за пудинга е в яденето.

3. Намалете времето на цикъла и сведете до минимум температурните разлики на

стъпки във вашия qPCR

В време на изпълнение на qPCR до голяма степен зависи от скоростите на нарастване, което е времето, през което циклерът трябва да променя температурите. Намаляването на температурните разлики може да има голям ефект!

Доказано е, че успешни PCR резултати могат да бъдат генерирани с справедливо широки времеви условия и диапазон от температури. Бъстин (2017) тества шест различни условия на qPCR цикъл за шест произволно избрани гена в клетъчна линия на рак на гърдата (MCF-7) върху два различни qPCR цикъла. Времето и температурите на денатурация, както и времето за отгряване/удължаване и температурата бяха различни (Таблица 1) доста широко и (изненадващо) генерираха приблизително същия брой цикли на количествено определяне (Cqs), наричани още прагов цикъл (Ct).

Таблица 1: Различни qPCR реакционни условия за анализи, които са проведени паралелно на два различни qPCR цикъла.

Денатурация Отгряване/полимеризация

95°C за 5 секунди 60°C за 15 секунди

93°C за 1 секунда 60°C за 5 секунди

93°C за 1 секунда 60°C за 1 секунда

90°C за 1 секунда 60°C за 15 секунди

90°C за 1 секунда 60°C за 1 секунда

88°C за 1 секунда 60°C за 1 секунда

Анализът на кривата на стопяване показва, че едни и същи ампликони са произведени при всички различни условия, с изключение на Ubiquitin C на един от циклерите.

В заключение, това показа, че добри резултати от qPCR може да се получи с по-ниски температури на денатурация и по-кратки времена на денатурация и отгряване/удължаване! Времето за извършване на цикъл от 40 цикъла с коригирани условия, както е описано, отне само около 60% от времето на бягане със стандартни условия (Bustin, 2017).

4. Изберете надеждни и тествани инструменти за проектиране за перфектен PCR праймер и

qPCR анализи

Надежден и изпитан на Eurofins Genomics Инструменти за проектиране на PCR праймери са базирани на „Prime+“ от пакета GCG Wisconsin, който първоначално е написан от Irv Edelman, подобрен с допълнителни параметри за перфектен дизайн на PCR праймер и сонда.

При избора на подходящи комбинации PCR праймер/сонда за генотипиране и анализи за генна експресия, различни ограничения върху PCR праймера, сондата и амплифицирания продукт се вземат предвид и частично предварително са определени като стойности по подразбиране в нашия дизайн на qPCR анализ. За би-плекс Дизайнът на qPCR анализа, всички праймери и сонди отново се проверяват един срещу друг. Резултатите се оценяват според най-добре предвидените критерии за ефективност.

За ваше удобство можете директно поръчайте избраните двойки PCR праймери или комбинации PCR праймер/сонда в нашия магазин.

5. Бързи PCR праймери за ускоряване на вашия qPCR проект

Eurofins Genomics високо качество NightXpress (q)PCR праймери ще увеличи завършването на вашия qPCR проект. Поръчайте днес и ще бъдат доставени по-малко от 24 часа! Така че можете почти веднага да започнете вашето qPCR-базирано изследване.

(q)PCR Primer NightXpress е подходящ за всеки вид стандартен PCR в реално време. Ние гарантираме точни и надеждни количества грунд с висока чистота. Също така, ниската концентрация на сол на тези праймери дава стабилни температури на топене (Tm).

Бонус съвет за ускоряване на публикуването на вашите qPCR резултати:

Използвайте указанията на MIQE

Минималната информация за публикуване на количествени PCR експерименти в реално време (MIQE) насоките предоставят методи за проектиране на qPCR експерименти, за да се гарантира последователност при публикуване на данни. Спазването на тези указания ще подпомогне генерирането на надеждни qPCR данни, които са сравними и възпроизводими (съгласуваност между експериментите) (Bustin et al., 2009). Това също ще допринесе за получаването на вашите публикувани данни.

От д-р Андреас Еберц

- Bustin, S.A. (2017) Как да ускорим полимеразната верижна реакция. Biomol Detect Quantif. 12: 10-4.

- Бъстин, SA, Benes, V., Garson, JA, Hellemans, J., Huggett, J., Kubista, M., Mueller, R., Nolan, T., Pfaffl, MW, Shipley, GL, Vandesompele, J ., Wittwer, CT

(2009) Насоките на MIQE: Минимална информация за публикуване на количествени PCR експерименти в реално време. Clin. Chem. 55(4): 611–22.


PCR - намалена ефективност на свързване с по-ниско Tm? - (29 февруари 2008 г.)

Знам, че обичайното правило за PCR е, че по-високата температура на топене повишава специфичността на свързването на праймера (и затруднява свързването на праймерите с последователност, която не е идеално съвпадаща) и обратно (така че при по-ниска температура може да получите множество ленти от много неспецифично свързване).

Някой чувал ли е да се е случило обратното?? Имам проблеми с определен набор от грунд от известно време и в някои случаи по-ниската температура на топене води до негативи, които са положителни при по-висока температура на топене. Много съм объркана.

Знам, че обичайното правило за PCR е, че по-високата температура на топене увеличава специфичността на свързването на праймера (и затруднява свързването на праймерите с по-малко от идеално съвпадаща последователност) и обратно (така че при по-ниска температура може да получите множество ленти от много неспецифично свързване).

Някой чувал ли е да се е случило обратното?? От известно време имам проблеми с определен набор от грунд и в някои случаи по-ниската температура на топене води до отрицателни резултати, които са положителни при по-висока температура на топене. Много съм объркана.

Сигурни ли сте дали това, което виждате като положително, е наистина положително? Не може ли да се случи това, което виждате да е неспецифично и когато увеличите температурата да изчезне??

Знам, че обичайното правило за PCR е, че по-високата температура на топене увеличава специфичността на свързването на праймера (и затруднява свързването на праймерите с по-малко от идеално съвпадаща последователност) и обратно (така че при по-ниска температура може да получите множество ленти от много неспецифично свързване).

Някой чувал ли е да се е случило обратното?? Имам проблеми с определен набор от грунд от известно време и в някои случаи по-ниската температура на топене води до негативи, които са положителни при по-висока температура на топене. Много съм объркана.

При PCR за потискане (използва се само един праймер, съответстващ на обърнатите крайни повторения на целта), намалената температура на отгряване може да намали ефективността на отгряване на праймер-шаблон.


Полимеразна верижна реакция (PCR)

Полимеразната верижна реакция (PCR) е метод за бързо амплифициране на последователности от ДНК. По време на типичен PCR, матрицата ДНК (съдържаща интересуващата ни област) се смесва с дезоксинуклеотиди (dNTPs), ДНК полимераза и праймери. Праймерите са къси сегменти от ДНК, които са комплементарни с шаблонната ДНК нагоре по веригата на областта на интерес и служат като места за набиране на полимеразата. PCR включва серия от температурни цикли, които, въпреки че някога са били провеждани чрез преместване на тръби през различни водни бани, сега се контролират автоматично чрез използването на термоциклери или термоциклери. Термоциклерите осигуряват строг контрол както върху реакционната температура, така и върху продължителността на всяка температурна стъпка, осигурявайки ефективно усилване. По време на типичен PCR циклите на денатурация, отгряване и удължаване се повтарят, за да се постигне експоненциално усилване на целевата последователност. Денатурацията се състои в нагряване на пробите обикновено между 94-98°C, за да се предизвика денатурация на шаблонната ДНК, разрушаване на водородните връзки и взаимодействията при подреждане на основи, които държат ДНК нишките заедно. След като нишките са разделени, температурата се понижава до температурата на отгряване, за да се позволи на праймерите да се сдвоят (или отгряват) към комплементарни области на шаблона. Температурата на отгряване (обикновено между 48-72°C) е свързана с температурата на топене (Tm) на праймерите и трябва да бъде определена за всяка двойка праймери, използвана в PCR. По време на стъпката на удължаване (обикновено 68-72°C) полимеразата удължава праймера, за да образува зараждаща се ДНК верига. Този процес се повтаря многократно (обикновено 25-35 цикъла) и тъй като всяка нова нишка може да служи и като шаблон за праймерите, областта на интерес се усилва експоненциално. Последната стъпка на PCR обикновено е по-дълга, единична температурна стъпка (често 5-10 минути при 68-72°C), която позволява завършването на всякакви частични копия и изчистването на всички машини за репликация от зараждащата се ДНК. След като PCR приключи, термичният цикъл се настройва на 4°-10°C, за да се поддържа целостта на продукта, докато епруветките могат да бъдат извадени от машината.


Въведение

Амплификацията на целеви ДНК последователности с високо съдържание на GC (>60%) може да бъде пречка за успешния PCR. Този проблем се усложнява от високата вероятност за образуване на вторични структури като фиби в ДНК шаблони, образуване на димер на самостоятелен и кръстосан праймер. Такива структури могат да блокират ДНК полимеразата и/или да предотвратят отгряване на праймери към шаблоните, като по този начин прекратяват синтеза на новата ДНК верига по време на PCR. В допълнение, клонирането на гени с високо съдържание на GC чрез PCR, използвайки дълги праймери, може да представлява допълнително предизвикателство за процеса на амплификация поради високата температура на топене (Tm) поради допълнителната водородна връзка между базовите двойки цитозин и гуанин (Borah, 2011).

Проучванията, целящи преодоляване на тези проблеми, обърнаха специално внимание на праймерите, разтворите за усилване и цикличните условия. Препоръчва се дължината на праймерите да се поддържа между 15 и 30 нуклеотидни остатъци (бази) и да има Tm между 52 и 58 °C. (Бора, 2011). Добавянето на подобрители като бетаин, диметилсулфоксид (DMSO) и формамид може да модифицира характеристиките на топене на двойноверижните ДНК спирали, позволявайки лесно разделяне на нишките. Бетаинът е аналог на аминокиселината, който намалява енергията, необходима за денатурация на ДНК вериги. DMSO пречи на образуването на водородна връзка, предотвратявайки повторното отгряване между и вътрешно вериги. (Jensen et al., 2010 Ralser et al., 2006 Rees et al., 1993). Формамид повишава PCR специфичността при работа с мишени, богати на GC (Sarkar et al., 1990). Модификацията на цикличните условия също се разглежда, като това включва оптимизиране на температурата на отгряване, прилагане на PCR с горещ старт и използване на вложена PCR и PCR при докосване (Don et al., 1991 Lorenz, 2012).

Отбелязва се, че дори и с приемането на гореспоменатите подходи, все още съществуват предизвикателства пред амплификацията, особено при използване на богати на GC шаблони, дълги праймери и целящи усилване на по-дълги продукти. Освен това, по-голямата част от публикуваната литература се фокусира върху амплификацията на гени под 1 килобаза и оптимизирането на условията, свързани с един PCR продукт (Frey et al., 2008 Jensen et al., 2010 Kumar et al., 2014 Mamedov et al. ., 2008 Ralser et al., 2006) обаче, те не се отнасят до работата с множество дълги цели, богати на GC (>1 kb). В контекста на друг проект в нашата лаборатория, целящ амплификация и клониране на множество богати на GC ORF от Mycobacterium bovis genome, a standard procedure that enables amplification of these targets simultaneously was required without the need to optimize individual conditions for each target. This provoked us to design this study that tested and compared the PCR amplification of one “difficult” target as a model, Mb0129 от M. bovis, a large-sized gene 1794 bp and a GC content 77.5%, and two relatively “easier” targets, mpb83 (Mb2898) от M. bovis, a 663 bp gene and 63% GC content, and LMHCC_RS00060 от Listeria monocytogenes, a 1617 bp gene and 41.5% GC. Three PCR protocols were designed and experimented with each of the three genes using five different polymerase enzymes in the presence or absence of enhancers.


Подкрепяща информация

S1 Fig. Sequencing workflow using targeted-amplicon sequencing (TAS) (A) and the polymerase-exonuclease-PCR (PEX PCR) method (B).

The TAS workflow consists of two PCR stages in which template-specific primers containing 5’ linker sequences are used to amplify from template DNA. Subsequently, an aliquot of the first PCR is transferred to a second reaction for amplification with primers containing NGS sequencing adapters and a sample-specific barcode. In the PEX PCR method, a modified workflow is used the first stage reaction is truncated after 2 cycles, primers are removed using exonuclease digestion, and the exonuclease-treated reaction mixture is subsequently PCR-amplified with primers containing sequencing adapters and barcodes. AT = annealing temperature ET = Elongation time.

S2 Fig. Effect of 5-nitroindole substitution and amplification strategy on observed microbial community structure and primer utilization patterns.

(А) Non-metric multidimensional scaling (NMDS) plot of lake sediment microbiome, performed at the taxonomic level of family and based on Bray-Curtis similarity (2D stress = 0.02). Samples were rarefied to 4,750 sequences per sample and no transformation was applied. Symbols are color-coded by the diversity (Shannon Index) of reverse primers (и.д. 806R) detected in the sequences. Maximum possible Shannon index for 18 primers in the primer pool is 2.89. Reactions in which the 806R primer with 5-nitroindole (806R-NI) substitutions was used were less reproducible. (Б) Group-average dendogram of observed lake sediment microbial community structure from a single sample as amplification method is altered. gDNA was PCR amplified using the standard TAS reaction and with PEX PCR reactions with and without exonuclease and with and without primers containing 5-nitroindole substitutions. Bray-Curtis similarity scores were generated based on family-level taxonomic classification, generated as described in the text. Data were standardized but not transformed. Clusters containing all three replicates from a single treatment are indicated by a symbol at the node. (° С) Dendogram and heatmap of reverse (806R) primer utilization patterns for the same samples. Bray-Curtis similarity was generated based on standardized abundance of each of 18 primer variants present in the reverse primer pool. The heatmap indicates relative abundance of each primer variant for each sample, with primers ordered by increasing theoretical Tm. A separate column (at the very bottom) indicates the relative abundance of variants potentially present when 5-nitroindole primers are used.

S3 Fig. Effect of method and annealing temperature on primer utilization patterns in mock DNA.

Dendogram and heatmap of reverse primer utilization patterns for the mock community analyzed using the TAS and PEX PCR methods, at temperatures from 30°-55°C. Bray-Curtis similarity was generated based on standardized abundance of each of 18 primer variants present in the reverse primer pool. The heatmap indicates relative abundance of each primer variant for each sample, with primers ordered by increasing theoretical Tm. All reactions using the TAS method clustered together (node indicated by a blue circle). Underlined samples are analyzed at the individual template level in S4 Fig.

S4 Fig. Effect of method and annealing temperature on primer utilization patterns for each mock template.

Dendogram and heatmap of reverse primer utilization patterns for the mock community analyzed using the TAS and PEX PCR methods, at temperatures of 45° and 55°C. Bray-Curtis similarity was generated based on standardized abundance of each of 18 primer variants present in the reverse primer pool. The heatmap indicates relative abundance of each primer variant for each template within the mock community DNA pool, with primers ordered by increasing theoretical Tm.

S5 Fig. Effect of annealing temperature on observed microbial community structure and primer utilization patterns.

(А) Group-average dendogram of observed mammalian fecal microbial community structure from a single sample (“Chin”) as PEX PCR stage 1 annealing temperature is altered. Labeled nodes indicate grouping of replicates from a single annealing temperature (* indicates a single replicate from 55°C is included). Bray-Curtis similarity scores were generated based on family-level biological data, generated as described in the text. Data were standardized but not transformed. (Б) Dendogram and heatmap of reverse primer utilization patterns for the same samples. Bray-Curtis similarity was generated based on standardized abundance of each of 18 primer variants present in the reverse primer pool. The heatmap (0–75%) indicates the relative abundance of each primer variant for each sample, with primers ordered by increasing theoretical Tm.


Гледай видеото: DRİFT YAPARAK KIZ TAVLAMA: (Юни 2022).


Коментари:

  1. Shakashicage

    Мисля, че грешиш. Мога да го докажа. Пишете ми в PM, ще поговорим.

  2. Tibalt

    I regret, that I can not participate in discussion now. It is not enough information. But with pleasure I will watch this theme.

  3. Shandley

    Може да се обсъжда безкрайно.



Напишете съобщение