Информация

9.5C: Тъканният тропизъм в животинските вируси - Биология

9.5C: Тъканният тропизъм в животинските вируси - Биология


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Тропизмът на гостоприемника се отнася до начина, по който вирусите/патогените определят кои клетки се заразяват от даден патоген.

Цели на обучението

  • Обяснете вирусния тропизъм

Ключови точки

  • Вирусите трябва да се свържат със специфични рецептори на клетъчната повърхност, за да влязат в клетката.
  • Ако една клетка не експресира тези рецептори, вирусът не може нормално да я зарази.
  • Във вирусологията тъканният тропизъм е клетките и тъканите на гостоприемника, които поддържат растежа на конкретен вирус или бактерия. Някои вируси имат широк тъканен тропизъм и могат да заразят много видове клетки и тъкани. Други вируси могат да заразят предимно една тъкан.

Ключови условия

  • дендритна клетка: Всяка клетка, която има разклонителни процеси, която е част от имунната система на бозайниците.
  • макрофаг: Бели кръвни клетки, които фагоцитират некротичните клетъчни остатъци и чужд материал, включително вируси, бактерии и мастило за татуировки. Той представя чужди антигени върху МНС II на лимфоцитите. Част от вродената имунна система.

Тропизмът е биологично явление, което показва растеж или обръщане на биологичен организъм в отговор на стимул от околната среда. При тропизмите този отговор зависи от посоката на стимула (за разлика от настичните движения, които са ненасочени реакции). Вирусите и други патогени също засягат това, което се нарича „тропизъм на гостоприемника“ или „клетъчен тропизъм“. ” Случайният тропизъм се отнася до начина, по който различните вируси/патогени са еволюирали, за да се насочат преференциално към специфични видове гостоприемници или специфични типове клетки в рамките на тези видове.

Тропизъм на гостоприемника е името, дадено на процес на тропизъм, който определя кои клетки могат да се заразят от даден патоген. Тропизмът на гостоприемника се определя от биохимичните рецепторни комплекси върху клетъчните повърхности, които са разрешителни или непозволителни за докинг или прикрепване на различни вируси.

Различни фактори определят способността на патогена да инфектира определена клетка. Например, вирусите трябва да се свържат със специфични рецептори на клетъчната повърхност, за да влязат в клетката. Ако една клетка не експресира тези рецептори, вирусът не може нормално да я зарази. Вирусният тропизъм се определя от комбинация от чувствителност и разрешителност: клетката гостоприемник трябва да бъде едновременно разрешителна (позволява навлизане на вируса) и чувствителна (притежава рецепторния комплемент, необходим за навлизане на вируса), за да може вирусът да установи инфекция. Пример за това е вирусът на ХИВ, който проявява тропизъм за свързаните с CD4 имунни клетки (например Т-хелперни клетки, макрофаги или дендритни клетки). Тези клетки експресират CD4 рецептор, към който вирусът на ХИВ може да се свърже чрез gp120 и gp41 протеините на повърхността му.

Във вирусологията тъканният тропизъм е клетките и тъканите на гостоприемника, които поддържат растежа на конкретен вирус или бактерия. Други вируси могат да заразят предимно една тъкан.

Факторите, влияещи върху тропизма на вирусната тъкан, включват: 1) наличието на клетъчни рецептори, позволяващи навлизането на вируса, 2) наличието на транскрипционни фактори, участващи във вирусната репликация, 3) молекулярната природа на вирусния тропоген и 4) клетъчните рецептори са протеините, намиращи се на клетка или вирусна повърхност.

Тези рецептори са като ключове, позволяващи на вирусната клетка да се слее с клетка или да се прикрепи към клетка. Начинът, по който тези протеини се придобиват, е чрез процес, подобен на този при цикъл на инфекция.


Система за доставяне на азотен оксид и методи за използване

Изпълнения на настоящото разкритие осигуряват системи и устройства за доставяне на газообразен азотен оксид (gNO) при терапевтични параметри за намаляване на инфекцията при субект. Някои изпълнения включват устройства и системи за доставяне на gNO под налягане за намаляване на биологичното натоварване и насърчаване на заздравяването на рани на субекти с различни болестни състояния, включително инфекции на кожата и меките тъкани (SSTI) и остеомиелит. В някои изпълнения, настоящото разкритие предоставя преносими устройства за заздравяване на рани за доставяне на gNO под налягане до мястото на раната за лечение на различни болестни състояния при субект.

Настоящата заявка претендира за ползата от временната заявка за патент на САЩ сер. № 62/079,461, подадена на 13 ноември 2014 г. Тази заявка е включена тук чрез препратка в своята цялост за всички цели.

ИЗЯВЛЕНИЕ ОТНОСНО ФЕДЕРАЛНО ФИНАНСИРАНИТЕ ИЗСЛЕДВАНИЯ

Изпълненията, разкрити тук, са подкрепени отчасти от Агенцията за напреднали изследователски проекти в областта на отбраната (DARPA), DARPA Грант № HR 0011-11-1-0006. Правителството има определени права върху това изобретение.

Изпълнения на настоящото разкритие осигуряват системи и устройства за доставяне на газообразен азотен оксид (gNO) при терапевтични параметри за намаляване на насочена инфекция в субект. Някои изпълнения включват устройства и системи за доставяне на gNO под налягане за намаляване на бионатоварването и насърчаване на заздравяването в раните на субект, който има едно или повече здравословни състояния, включително, но не само, инфекции на кожата и меките тъкани (SSTI) и/или остеомиелит. Някои изпълнения, разкрити тук, се отнасят до намаляване на патогенните инфекции в меките тъкани на субект, за да се насърчи заздравяването на рани при персистиращи или хронични рани.

Азотният оксид (NO) е повсеместен пратеник на малки молекули, участващ в много патологични и физиологични процеси. NO играе критична роля в пътищата на съдова и невронна сигнална трансдукция, контрактилитета на гладката мускулатура, биоенергетиката, адхезията и агрегацията на тромбоцитите, имунитета и регулирането на клетъчната смърт. Дефицитът на NO е замесен в много патофизиологични процеси като хипертония, сърдечно-съдови дисфункции, невродегенерация, артрит, астма и септичен шок. NO е една от малкото известни газообразни сигнални молекули и освен това е изключителна поради факта, че е радикален газ. Той е известен страничен продукт в почти всички видове организми, вариращи от бактерии до растения, гъбички и животински клетки.

Има няколко механизма, чрез които е доказано, че NO влияе върху биологията на живите клетки. Те включват окисляване на съдържащи желязо протеини като рибонуклеотидна редуктаза и аконитаза, активиране на разтворимата гуанилатциклаза, ADP рибозилиране на протеини, нитрозилиране на протеин сулфхидрилна група и активиране на регулаторния фактор на желязото. Доказано е също, че NO активира NF-κB в мононуклеарни клетки на периферната кръв, важен транскрипционен фактор в експресията на iNOS ген в отговор на възпаление. Освен това, по време на имунен отговор, NO се секретира като свободни радикали и е токсичен за много бактерии и вътреклетъчни паразити. NO причинява увреждане на ДНК и разграждане на центровете на сяра на желязо в железни йони и желязо-нитрозилни съединения.

Прилагането на екзогенен NO не само представлява мощен начин за допълване на NO, когато субектът не може да генерира достатъчно за нормалните биологични функции, но също така предлага средство за ускоряване на заздравяването на рани и намаляване на бионатоварването на субекта. NO, произведен както от iNOS, така и от eNOS, играе много важни роли в заздравяването на рани, от фазата на възпаление до ремоделирането на белега. По-специално, NO проявява цитостатични, хемотактични и вазодилататорни ефекти по време на ранно възстановяване на рани, регулира пролиферацията и диференциацията на няколко типа клетки, модулира отлагането на колаген и ангиогенезата и повлиява свиването на раната. Въпреки това, времето, концентрацията, налягането и мястото на приложение на NO са слабо разбрани критични фактори, влияещи върху способността на NO да улеснява възстановяването на раната.

Изпълнения на настоящото разкритие осигуряват системи и устройства за доставяне на газообразен азотен оксид (gNO) при терапевтични параметри за намаляване на насочена инфекция в субект. Някои изпълнения включват устройства и системи за доставяне на gNO под налягане за намаляване на бионатоварването и насърчаване на заздравяването в раните на субект, който има едно или повече здравословни състояния, включително, но не само, инфекции на кожата и меките тъкани (SSTI) и/или остеомиелит. Някои изпълнения, разкрити тук, се отнасят до намаляване на патогенните инфекции в меките тъкани на субект, за да се насърчи заздравяването на рани при персистиращи или хронични рани.

Изпълнения на настоящото разкритие осигуряват устройство за доставяне на газообразен азотен оксид (gNO) за доставяне на gNO под налягане на субект. В някои изпълнения устройството включва източник на gNO, функционално свързан към интерфейсно устройство, регулатор на газовия поток, който измерва дебита на gNO и регулатор на налягането на газа, който измерва налягането на gNO, докато gNO се доставя през съответния интерфейс единица към субекта, при което gNO третира инфекция в субекта.

В някои изпълнения, налягането на gNO, доставена на субекта, е от около 0,15 ATM до около 1,0 ATM.

В други изпълнения, gNO се доставя на субекта със скорост на потока от около 0,1 литра/минута до около 1,0 литра/минута.

В някои изпълнения концентрацията на gNO, доставена на субекта, е около 1.0%.

В определени изпълнения, gNO се доставя на субекта непрекъснато за около 30 минути до около 120 минути.

В още други изпълнения, устройството може допълнително да включва един или повече сензори за азотен оксид.

В някои изпълнения устройството може допълнително да включва един или повече кислородни сензори.

В още друго изпълнение, устройството може допълнително да включва механизъм за промиване с газ, за ​​да се намали честотата или да се предотврати излагането на субекта на gNO, когато интерфейсното устройство на субекта се отстрани.

В някои изпълнения, предметният интерфейсен модул включва изход за газ, за ​​да осигури непрекъснат поток на gNO и непрекъснато излагане на gNO на субекта.

В определени изпълнения, интерфейсната единица на субекта включва механизъм за закрепване за поддържане на уплътнение върху субекта (или област от придатка на субекта), докато се доставя газът gNO.

В други изпълнения, лечението на инфекцията в субекта включва намаляване на бионатоварването в рана, разположена върху субекта.

В някои изпълнения, лечението на инфекцията в субекта може да включва намаляване на един или повече симптом(и), свързани с инфекцията.

В определени изпълнения, лечението на субекта включва намаляване на риска от развитие на инфекция на един или повече патогенни организми в субекта чрез предварителното им излагане на gNO преди началото на инфекция в мястото на раната. В съответствие с тези изпълнения, субектът може да бъде лекуван с gNO при представяне на нова рана.

В други изпълнения инфекцията включва област от тялото на субекта, заразена от поне един патоген, избран от групата, състояща се от бактерия, вирус, гъбичка, паразит, членестоноги, протозои и устойчива на антибиотици бактерия, или комбинация от тях.

В някои изпълнения инфекцията е лезия, включваща, но не ограничена до хирургична рана, рана от травма, изгаряне, абсцес, актинична кератоза, келоид, белег и рак на кожата и комбинация от тях.

Изпълненията на настоящото разкритие също включват система за доставяне на газообразен азотен оксид (gNO) за доставяне на gNO под налягане на субект. В някои изпълнения, системата включва източник на gNO, функционално свързан с предметно интерфейсно устройство, регулатор на газовия поток, който измерва дебита на gNO и регулатор на налягането на газа, който измерва налягането на gNO, докато gNO се доставя през съответния интерфейс единица към субекта, при което gNO лекува, предотвратява началото или намалява началото на инфекция в субекта.

В някои изпълнения съгласно системите, разкрити тук, налягането на gNO, доставяно на субекта, е от около 0,15 ATM до около 1,0 ATM, при което скоростта на потока на gNO, доставена на субекта, е от около 0,1 литра/минута до около 1,0 литра/ минута, и при което концентрацията на gNO, доставена на субекта, е около 1.0%.

В други изпълнения, системата, разкрита тук, включва един или повече сензори за кислород, азотен оксид или азотен диоксид.

В определени изпълнения, лечението на инфекция в субекта, използвайки система, разкрита тук, включва намаляване на бионатоварването (например, патогенни организми) в рана върху субекта.

В други изпълнения, системата, разкрита тук, може допълнително да включва включващ механизъм за промиване на газ, за ​​да се предотврати излагането на субекта на gNO, когато интерфейсното устройство на субекта е отстранено.

В определени изпълнения, предметният интерфейсен модул включва изход за газ, за ​​да осигури непрекъснат поток на gNO и непрекъснато излагане на gNO на субекта.

Изпълнения на настоящото разкритие също включват метод за лечение на рана върху субект. В някои изпълнения методът включва прикрепване на субектен интерфейс към мястото на раната на субекта, субектният интерфейсен модул функционално свързан с източник на газообразен азотен оксид (gNO) и доставяне на ефективно количество gNO към мястото на раната на субект, при което gNO третира мястото на раната върху субекта.

В някои изпълнения налягането на gNO, доставен до мястото на раната върху субекта, е от около 0,15 ATM до около 1,0 ATM, при което скоростта на потока на gNO, доставена до мястото на раната върху субекта, е от около 0,1 литра/минута до около 1,0 литра/минута, и при което концентрацията на gNO, доставена до мястото на раната върху субекта, е около 1,0%.

В някои изпълнения, gNO се доставя до мястото на раната върху субекта непрекъснато за около 30 минути до около 120 минути.

В други изпълнения, лечението на мястото на раната включва намаляване на бионатоварването при инфекция в мястото на раната.

В някои изпълнения, лечението на мястото на раната включва намаляване на риска от развитие на инфекция в мястото на раната.

Както се използва тук, термините „субект“, „потребител“ и/или „пациент“ могат да включват хора и други животни или бозайници, които се нуждаят от лечение и могат да използват или имат асистирана употреба на устройства и системи, както е описано тук. В допълнение, термините „субект“, „потребител“ и/или „пациент“ могат да включват хора и други бозайници, лекувани във всякакъв вид среда, като например клинична среда, неклинична среда, експериментална среда и т.н. В изпълнения, а потребителят може да не е в състояние ефективно да управлява различните системи за доставка на gNO и може да се нуждае от помощта на трета страна. Като такива, функциите, изпълнявани от „потребителя“, могат да включват функции, изпълнявани от доставчик трета страна, като доставчик на здравни услуги и/или друго упълномощено лице, свързано с потребителя.

Термините „определяне“, „изчисляване“ и „изчисляване“ и техните вариации, както се използват тук, се използват взаимозаменяемо и включват всякакъв вид методология, процес, математически операции или техника.

Трябва да се отбележи, че терминът "а" или "едно" се отнася до едно или повече от това образувание. Като такива, термините "а" (или "an"), "един или повече" и "поне един" могат да се използват взаимозаменяемо тук. Трябва също да се отбележи, че термините „съдържащ“, „включително“ и „имащ“ могат да се използват взаимозаменяемо.

Както се използва тук, "поне един", "един или повече" и "и/или" са изрази с отворен край, които са едновременно конюнктивни и дизюнктивни в действие. Например всеки от изразите „поне един от A, B и C“, „поне един от A, B или C“, „един или повече от A, B и C“, „един или повече от A, B или C“ и „A, B и/или C“ означава A самостоятелно, B самостоятелно, C самостоятелно, A и B заедно, A и C заедно, B и C заедно или A, B и C заедно. Когато всеки от A, B и C в горните изрази се отнася до елемент, като X, Y и Z, или клас елементи, като X1-Xn, Y1-Ym и Z1-Zo, фразата е предназначен да се отнася до един елемент, избран от X, Y и Z, комбинация от елементи, избрани от един и същи клас (напр. X1 и X2), както и комбинация от елементи, избрани от два или повече класа (например, Y1 и Zo).

Терминът „средства“, както е използван тук, ще получи възможно най-широко тълкуване в съответствие с 35 U.S.C. § 112 (е). Съответно, претенция, включваща термина „средства“, обхваща всички структури, материали или действия, изложени тук, и всички техни еквиваленти. Освен това, структурите, материалите или актовете и техните еквиваленти включват всички описани в резюмето, краткото описание на чертежите, подробното описание, резюмето и самите претенции.

Трябва да се разбере, че всяко максимално числово ограничение, дадено в това разкритие, се счита, че включва всяко по-ниско числово ограничение като алтернатива, сякаш такива по-ниски цифрови ограничения са изрично написани тук. Всяко минимално числово ограничение, дадено в това разкритие, се счита, че включва всяко по-високо числово ограничение като алтернатива, сякаш такива по-високи числени ограничения са изрично написани тук. Всеки числов диапазон, даден в това разкритие, се счита, че включва всеки и всеки по-тесен числов диапазон, който попада в такъв по-широк числов диапазон, сякаш всички тези по-тесни числови диапазони са изрично написани тук.

Предходното е опростено резюме на разкритието, за да се осигури разбиране на някои аспекти на разкритието. Това резюме не е нито обширен, нито изчерпателен преглед на разкритието и неговите различни аспекти, изпълнения и конфигурации. То не е предназначено нито да идентифицира ключови или критични елементи на разкритието, нито да очертае обхвата на разкритието, а да представи избрани концепции на разкритието в опростена форма като въведение към по-подробното описание, представено по-долу. Както ще бъде оценено, други аспекти, изпълнения и конфигурации на разкритието са възможни, като се използват, самостоятелно или в комбинация, една или повече от характеристиките, изложени по-горе или описани подробно по-долу.

КРАТКО ОПИСАНИЕ НА ЧЕРТЕЖИТЕ

Придружаващите чертежи са включени и са част от спецификацията, за да илюстрират няколко примера на настоящото разкритие. Тези чертежи, заедно с описанието, обясняват принципите на разкриването. Чертежите просто илюстрират предпочитани и алтернативни примери за това как разкритието може да бъде направено и използвано и не трябва да се тълкува като ограничаване на разкритието само до илюстрираните и описани примери. Допълнителни характеристики и предимства ще станат очевидни от следващото, по-подробно описание на различните аспекти, изпълнения и конфигурации на разкритието, както е илюстрирано от чертежите, посочени по-долу.

ФИГ. 1 е изображение на преносимо устройство за доставяне на газообразен азотен оксид (gNO), съгласно едно изпълнение на настоящото разкритие.

ФИГ. 2A-2C са представяния на три предметни интерфейсни единици, които се свързват към устройството за доставяне на NO, съгласно изпълнения на настоящото разкритие.

ФИГ.3 е представителен чертеж на преносимо устройство за доставяне на gNO, което не изисква колектор, съгласно едно изпълнение на настоящото разкритие.

ФИГ. 4 е графика, илюстрираща ефектите от третирането с gNO върху биологичното натоварване след три часа бактериална инфекция, съгласно едно изпълнение на настоящото разкритие.

ФИГ. 5А-5С са представителни хистологични срезове, оцветени за откриване на наличието на бактерии върху третирана и нетретирана тъкан, съгласно изпълнения на настоящото разкритие. (ФИГ. 5А: наранена, неинфектирана тъкан ФИГ. 5В: тъкан наранена и инфектирана за 3 часа и ФИГ. 5С: тъкан наранена и инфектирана за 24 часа)

ФИГ. 6A-6F са представителни хистологични срезове, оцветени за откриване на компоненти на бактериален биофилм, съгласно едно изпълнение на настоящото разкритие. (ФИГ. 6А е оцветена с хематоксилин и еозин. ФИГ. 6В е оцветена с реакция на Feulgen. Фигура 6C е оцветена с модифицирано конго червено. Фигура 6D е оцветена с модифицирано конго червено с карбол фуксин. оцветени с Calcofluor)

Докато разкритието е податливо на различни модификации и алтернативни форми, специфичните изпълнения са илюстрирани като пример в чертежите и са описани подробно по-долу. Намерението обаче не е да се ограничава разкриването до конкретните описани изпълнения. Напротив, разкритието има за цел да покрие всички модификации, еквиваленти и алтернативи, попадащи в обхвата на разкритието и/или претенциите.

ПОДРОБНО ОПИСАНИЕ

Изпълнения на настоящото разкритие осигуряват системи и устройства за доставяне на газообразен азотен оксид (gNO) при терапевтични параметри за намаляване на инфекцията при субект. Някои изпълнения включват устройства и системи за доставяне на gNO под налягане за намаляване на биологичното натоварване и насърчаване на заздравяването на рани на субекти с различни болестни състояния, включително инфекции на кожата и меките тъкани (SSTI) и остеомиелит.

ФИГ. 1 е представяне на преносимо устройство за доставяне на gNO, съгласно едно изпълнение на настоящото разкритие. Преносимото устройство за доставяне на NO от настоящото разкритие може да включва колектор 100 който включва регулатор на налягането на газа 105, регулатор на газовия поток 110, и субектен интерфейс. Устройствата и системите за доставка на gNO позволяват лесно транспортиране на устройството до различни места, където терапевтичната интервенция не е поносима за болнична обстановка. Както е илюстрирано на фиг. 1, газови колектори 100 използвани с устройствата и системите за доставяне на gNO от настоящото разкритие могат да включват различни характеристики за контролиране на доставката на газ към субект (например, газови колектори от ALICAT SCIENTIFIC). Например, газовите колектори, използвани с преносимите устройства за доставяне на NO и системи от настоящото разкритие, могат да включват порт за поставяне на източник на енергия 115 и/или порт за поставяне на един или повече акумулаторни батерии (не е илюстриран), различни цифрови показания за концентрация на газ и налягане 120, различни входове за газ 125 и изходи 130и различни сензори за концентрация на газ 135. Газовите колектори, използвани с преносимите устройства и системи за доставяне на NO от настоящото разкритие, могат да бъдат функционално свързани с интерфейсния блок на обекта, за да се улесни прилагането на NO към субект. Различни типове и модели газови колектори могат да бъдат използвани за доставяне на gNO под налягане на субект, както би било признато от специалист или обикновен специалист в областта на базата на настоящото разкритие.

В някои изпълнения, преносимите устройства за доставяне на gNO от настоящото разкритие включват източник на gNO, като например контейнер за съхранение на gNO, който съхранява gNO преди доставката на субект. Контейнерът за съхранение на gNO може да бъде всеки подходящ резервоар или цилиндър, който съдържа компресиран gNO от медицински клас за доставка до субект. Подходящите цилиндри за съхранение на GNO могат също да бъдат оборудвани с манометри или регулатори, манометри или регулатори на потока, копчета за настройка за регулиране както на изходното налягане, така и на дебита, входове/изходи за газ и други подобни. В някои аспекти, цилиндърът на gNO може да включва специфично количество gNO (например, литри gNO), така че доставянето на gNO на субект с определено състояние да представлява еднократно лечение. Например, цилиндър за съхранение на gNO може да съдържа приблизително 9,0 литра gNO, така че когато се доставя на субект в продължение на 90 непрекъснати минути при скорост на потока от 0,1 литра в минута (LPM), gNO ще бъде изчерпан. При този начин на работа цилиндърът за съхранение на gNO може да функционира като защитна функция, за да се предотврати прекомерното излагане на gNO на обекта.

В някои изпълнения, gNO, доставен на субект, е част от газова смес, която има концентрация на NO, която варира от около 1 ppm до около 1500 ppm, от около 1000 ppm до около 5000 ppm, от около 4000 ppm до около 10 000 ppm , от около 9 000 ppm до около 16 000 ppm, от около 15 000 ppm до около 22 000 ppm, от около 21 000 ppm до около 28 000 ppm, от около 27 000 ppm до около 34 000 ppm до около 34 000 ppm до около 34 000 ppm до около 30 00 ppm. В някои аспекти, gNO, доставен на субекта, е 10 000 ppm, или около 1,0% от газовата смес (1 ppm е около 0,0001%).

В някои изпълнения устройството за доставяне на NO е оборудвано да доставя gNO при различни параметри, включително доставяне на gNO при различни налягания. В някои аспекти, gNO може да бъде доставен до субект при налягания някъде между около 0 атмосфери (ATM) до около 1 ATM (т.е. налягането в интерфейсната единица на субекта). Доставянето на gNO до субект в този диапазон е независимо и в допълнение към налягането на външната среда (например, барометрично налягане). Както би било разпознато от специалист в областта на техниката въз основа на настоящото разкритие, единиците за налягане могат да бъдат изразени с помощта на различни показатели, включително банкомати, паунд-сила на квадратен инч (например, lbf/in 2 или psi), бар ( например Mbar, kilobar, millibar и т.н.), паскал (напр. Pa, kPa, MPa и т.н.) и/или torr (напр. Torr, mTorr и т.н.). Например, 1 ATM може да бъде изразен като 14,695 psi. В някои аспекти на настоящото разкритие, налягането може да бъде измерено и изразено в стъпки, които са десети, стотни и/или хилядна от тези различни показатели. В някои аспекти gNO се доставя в различни диапазони. Например, газът gNO може да бъде доставен при налягания от около 0 ATM до около 1,0 ATM, от около 0 ATM до около 0,9 ATM, от около 0 ATM до около 0,8 ATM, от около 0 ATM до около 0,7 ATM, от около 0 ATM до около 0,6 ATM, от около 0 ATM до около 0,5 ATM, от около 0 ATM до около 0,4 ATM, от около 0 ATM до около 0,3 ATM, от около 0 ATM до около 0,2 ATM и от около 0 ATM до около 0,1 банкомат. В някои аспекти gNO може да се доставя при налягания от около 0,1 ATM до около 0,5 ATM, от около 0,15 ATM до около 1,0 ATM, от около 0,15 ATM до около 0,5 ATM, от около 0,15 ATM до около 0,25 ATM и от около 0,25 ATM до около 0,5 ATM. В някои аспекти gNO може да се доставя при налягания от около 0,1 ATM, около 0,15 ATM, около 0,2 ATM, около 0,25 ATM, около 0,3 ATM, около 0,4 ATM, около 0,45 ATM, около 0,5 ATM, около 0. ATM, около 0,6 ATM, около 0,65 ATM, около 0,7 ATM, около 0,75 ATM, около 0,8 ATM, около 0,85 ATM, около 0,9 ATM и около 0,95 ATM.

ФИГ. 2A-2B са представяния на две предметни интерфейсни единици, които се свързват към устройството за доставяне на NO, съгласно едно изпълнение на настоящото разкритие. Интерфейсните единици на субекта са частите от системата за доставяне на NO, които са поставени директно върху субекта, например около мястото на раната, така че NO се доставя до мястото на раната. Интерфейсният модул на обекта обикновено включва механизъм за закрепване за закрепване на интерфейсния модул на обекта върху обекта и/или поддържане или създаване на уплътнение върху обекта. В някои аспекти, както е илюстрирано на фиг. 2А, интерфейсното устройство на обекта 205 е с форма на чаша и включва монтажни ленти 210 които са леки, лесни за манипулиране и са направени от материали, подходящи за закрепване към обект. В някои аспекти, както е илюстрирано на фиг. 2B, интерфейсното устройство на обекта 215 е по-твърд и включва периферен вакуумен блок (не е илюстриран), който подпомага установяването и поддържането на уплътнение около порта за доставка на NO.

В други аспекти, както е илюстрирано на фиг. 2C , интерфейсното устройство на обекта 220 е конфигуриран да се побере около по-голяма площ от придатъка на субекта. Интерфейсното устройство на предмета 220 може да бъде гъвкава прозрачна кутия, която покрива, например, целия крак или ръка на обект. Интерфейсното устройство на предмета 220 може също да бъде твърда кутия, подобна на или цилиндрична структура, която обхваща по-голямата част от крака или ръката на субекта, например, и е конфигурирана да образува уплътнение около по-проксималната област на крака или ръката. Могат да се използват други конфигурации на интерфейсния модул на субекта и механизмите за закрепване, за да се закрепи интерфейсното устройство на субекта върху обекта и да се гарантира ефективното доставяне на NO на субекта. Както би било разпознато от специалист в областта на техниката въз основа на настоящото разкритие, такива конфигурации зависят от фактори като, но не само, размерът на мястото на лечение, неговото местоположение върху субекта, вида на инфекцията и харесването.

В някои изпълнения устройствата и системите за доставяне на gNO от настоящото разкритие могат да бъдат конфигурирани така, че газовият колектор да не е необходим, както е илюстрирано на фиг. 3 . Например устройството за доставка на gNO 300 може да включва източник за gNO 305 (например цилиндър или резервоар), който е директно и функционално свързан с механизми за регулиране на налягането на gNO и потока към предметния интерфейсен блок, като например регулатор на налягането на газа 310 и/или регулатор на газовия поток 315. Устройството за доставка на gNO 300 може също да включва цифрови и/или аналогови показания или дисплеи за визуализиране на налягането и потока на gNO, който се доставя на субекта на интерфейсния блок (например манометър, манометър). Устройството за доставка на gNO 300 може също да включва копчета за фина и/или груба настройка за регулиране на налягането и потока на подавания gNO. Устройството за доставка на gNO 300 може да включва и входове за газ 320 и изходи за газ 325 свързани с регулатори на налягането и дебита, както и входове за газ 330 и изходи за газ 335 свързан към интерфейсния модул на обекта 340.

Различни изпълнения на устройството за доставка на gNO 300 могат да осигурят допълнителни предимства от това, че не изискват колектор или каквито и да било електронни компоненти, следователно те могат да бъдат по-лесно разгърнати при спешни медицински ситуации. В някои аспекти, gNO цилиндърът, използван с тези gNO устройства, може да включва специфично количество gNO (например литри gNO), така че доставянето на gNO на субект представлява еднократно лечение. Например, цилиндър за съхранение на gNO може да съдържа приблизително 9,0 литра gNO, така че когато се доставя на субект в продължение на 90 непрекъснати минути при скорост на потока от 0,1 литра в минута (LPM), gNO ще бъде изчерпан. При този начин на работа цилиндърът за съхранение на gNO може да функционира като защитна функция, за да се предотврати прекомерното излагане на gNO на обекта.

Предметните интерфейсни единици от настоящото разкритие могат да бъдат покрити с вещества, които помагат за предотвратяване или намаляване на замърсяването от микроорганизми, бактерии, гъбички, вируси и други подобни. Покритията могат да бъдат активни фармацевтични агенти, които намаляват растежа и/или оцеляването на тези вредни микроорганизми (напр. антибактериални вещества) и/или покритията могат да функционират пасивно за предотвратяване или намаляване на замърсяването, например чрез предотвратяване на прилепването на тези микроорганизъм към различните повърхности на предметните интерфейсни единици (напр. овлажняващи агенти).

Подходящите материали, които могат да бъдат използвани за конструиране на предметните интерфейсни единици на настоящото разкритие включват, но не се ограничават до различни пластмаси и полимерни материали, като полистирол (PS), поликарбонат (PC), акрилонитрил-бутадиен-стирол (ABS) , полибутилен терефталат (PBTP), стирен акрилонитрил (SAN), полиамид (PA), полиоксиметилен (POM), полифениленоксид (PPO), PE, PP, PTFE и хомополимери и съполимери на тези пластмаси и подобни материали, известни в областта на техниката относно настоящото разкритие. Пластмасите могат също да се използват в напълнена или подсилена с влакна форма и/или свързани с части от метали или метални сплави, като алуминий, титан, стомана и техни комбинации. Материалите, използвани за конструирането на предметните интерфейсни единици, могат да бъдат повърхностно покрити, например с бои, лакове или лакове. Възможно е и използването на цветни пластмаси, например оцветени с пигменти.

Могат да бъдат конструирани различни други интерфейсни единици на субекта, в зависимост от характеристиките на мястото на раната, местоположението на мястото на раната, състоянието на субекта, средата, в която субектът трябва да бъде лекуван и други подобни. В някои аспекти, различните субектни интерфейсни единици могат да бъдат адаптирани за използване на модел върху субект, но в in vitro настройка, за експериментални цели (вижте, например, ФИГ. 2С). Например, протезен крак или ръка могат да бъдат поставени в запечатан, цилиндрично оформен субектен интерфейс, конфигуриран да приема култивирани клетки и/или тъкани (например кожна тъкан с пълна дебелина). Такива конфигурации могат да се използват за провеждане на експерименти преди употреба върху действителен жив субект.

Каквато и да е конфигурацията на интерфейсния модул на субекта, е полезно да се установи и поддържа уплътнение върху субекта, така че NO да може да се прилага при достатъчно повишено налягане, за да осигури терапевтични ползи за субекта (напр. намаляване на биологичното натоварване, намаляване на инфекцията, ускоряване на заздравяването на рани и подобни). Както се използва тук, бионатоварването обикновено се отнася до броя на бактериите или други патогени, присъстващи на повърхност, например повърхността на тъкан или рана (например кожа и/или кост). Намаляването на бионатоварването обикновено корелира с намаляване или минимизиране на инфекцията, както и с различните симптоми, които придружават инфекцията (например болка, подуване, зачервяване, неприятна миризма, отделяне на кръв или гной и т.н.). Намаляването на бионатоварването и намаляването на инфекцията също са склонни да корелират с ускорено заздравяване на рани, възстановяване на тъканите и растеж на здрава тъкан. Прилагането на NO под налягане за определен период от време при дадена скорост на потока може да намали бионатоварването в раната на субекта, което от своя страна насърчава заздравяването.

Системите за доставяне на NO от настоящото разкритие могат да включват субектни интерфейсни единици, които имат способността да поддържат уплътнение върху субекта, когато се прилага NO между около 0,1 ATM (1,47 psi) до около 1,0 ATM (14,695 psi). В някои аспекти, прилагането на NO при налягане в диапазона от около 0,1 ATM (1,47 psi) до около 0,25 ATM (3,674 psi) е достатъчно за установяване и поддържане на уплътнение върху раната на субект и намаляване на бионатоварването в раната, като по този начин се ускорява заздравяването . В други аспекти, прилагането на NO при налягане в диапазона от около 0,1 ATM (1,47 psi) до около 0,15 ATM (2,20 psi) е достатъчно за установяване и поддържане на уплътнение върху раната на субект и за намаляване на бионатоварването в раната, като по този начин се ускорява изцеление. Прилагането на NO в тези диапазони на налягането е достатъчно за намаляване на бионатоварването, без значително да се компрометира жизнеспособността на клетките и тъканите на субекта.

В някои изпълнения, системите за доставяне на NO от настоящото разкритие могат да бъдат използвани за прилагане на NO към мястото на раната на субекта при определена скорост на потока. Както би било разпознато от специалист в областта на техниката въз основа на настоящото разкритие, единиците за дебит могат да бъдат изразени с помощта на различни показатели, включително литри/минута (LPM) и/или кубични сантиметри в минута (cm 3 /min или cc /мин). Например, NO може да бъде доставен на субект при скорост на потока, варираща от около 0,1 литра/минута до около 2,0 литра/минута, от около 0,1 литра/минута до около 1,9 литра/минута, от около 0,1 литра/минута до около 1,8 литра/минута, от около 0,1 литра/минута до около 1,7 литра/минута, от около 0,1 литра/минута до около 1,6 литра/минута, от около 0,1 литра/минута до около 1,5 литра/минута, от около 0,1 литра/минута до около 0,1 литра/минута до около 0,1 литра/минута до около 1,5 литра/минута. около 1,4 литра/минута, от около 0,1 литра/минута до около 1,3 литра/минута, от около 0,1 литра/минута до около 1,2 литра/минута, от около 0,1 до около 1,1 литра/минута, от около 0,1 литра/минута до около 1,0 литра/минута, от около 0,1 литра/минута до около 0,9 литра/минута, от около 0,1 литра/минута до около 0,8 литра/минута, от около 0,1 литра/минута до около 0,7 литра/минута, от около 0,1 литра/минута, от около 0,1 литра/минута. до около 0,6 литра/минута, от около 0,1 литра/минута до около 0,5 литра/минута, от около 0,1 литра/минута до около 0,4 литра/минута, от около 0,1 литра/минута до около 0,3 литра/минута и от около 0,1 литра/минута до около 0,2 литра/минута. В някои аспекти, NO може да бъде доставен на субект при скорост на потока от около 0,1 литра/минута, около 0,2 литра/минута, около 0,3 литра/минута, около 0,4 литра/минута, около 0,5 литра/минута, около 0,6 литра /минута, около 0,7 литра/минута, около 0,8 литра/минута и около 0,9 литра/минута, около 1,0 литра/минута, около 1,2 литра/минута, около 1,3 литра/минута, около 1,4 литра/минута, около 1,5 литра/ минута, около 1,6 литра/минута, около 1,7 литра/минута, около 1,8 литра/минута, около 1,9 литра/минута и около 2,0 литра/минута, или еквивалент.

В някои изпълнения, системите за доставяне на NO от настоящото разкритие могат да бъдат използвани за прилагане на NO към мястото на раната на субекта за определен период от време. Например, NO може да бъде доставен на субект за период от време, вариращ от около 30 минути до около 180 минути, от около 30 минути до около 170 минути, от около 30 минути до около 160 минути, от около 30 минути до около 150 минути. минути, от около 30 минути до около 140 минути, от около 30 минути до около 130 минути, от около 30 минути до около 120 минути, от около 30 минути до около 110 минути, от около 30 минути до около 90 минути, от около 30 минути минути до около 80 минути, от около 30 минути до около 70 минути, от около 30 минути до около 60 минути, от около 30 минути до около 50 минути и от около 30 минути до около 40 минути. В някои аспекти NO може да бъде доставен на субект за период от време от около 110 минути, около 105 минути, около 100 минути, около 95 минути, около 90 минути, около 85 минути, около 80 минути, около 75 минути, около 70 минути, около 65 минути, около 60 минути, около 55 минути, около 50 минути, около 45 минути, около 40 минути, около 35 минути, около 30 минути, около 25 минути, около 20 минути, около 15 минути, около 10 минути , и около 5 минути, или според преценката, че е подходяща за обекта и раната, която се изследва.

В някои изпълнения устройствата и системите за доставяне на NO от настоящото разкритие могат да включват един или повече газови сензори (например, електрохимични сензори) за измерване на концентрацията на един или повече газове, доставяни на субекта (ФИГ. 1, 135). Например, системите за доставяне от настоящото разкритие могат да включват сензори за азотен оксид, сензори за азотен диоксид и/или сензори за кислород. Тези сензори могат да бъдат функционално свързани към източника на газа (например, резервоар за NO или цилиндър) и/или те могат да бъдат свързани към обекта на интерфейсно устройство за измерване на концентрациите на газ на мястото на раната или инфекцията. В някои аспекти газовите сензори могат да помогнат за поддържане на постоянен дебит и концентрация на NO за даден период на третиране. В някои аспекти сензорите могат да покажат на потребителя (напр. доставчик на здравни услуги), че концентрацията на газа е над или под предписан праг за даден протокол за лечение за даден субект, в който случай потребителят може да коригира един или повече параметри, като регулатора на налягането на газа или регулатора на газовия поток, или потребителят може да спре обработката и да замени източника на газа с такъв с подходящите концентрации на газове. В други аспекти, газовите сензори могат да се използват като част от протокол за прочистване на системата, включително интерфейсната единица на субекта, от кислород, така че gNO може да бъде доставен на субект по начин, който по същество е свободен от кислород. Например, непрекъснат поток от gNO и/или болус от gNO може да бъде доставен до субект през интерфейсния модул на субекта, докато кислороден сензор измерва намаляващата концентрация на кислород в субекта за интерфейсно устройство. След като сензорът покаже, че в системата има малко или никакъв кислород, протоколът за лечение с gNO може да започне.

В допълнение, устройствата и системите за доставяне на NO от настоящото разкритие могат да включват механизъм за промиване. В някои аспекти механизмът за промиване може да се използва за промиване на NO, използван по време на лечението и възстановяване на нивата на кислород до нормални, така че субектът да не е изложен на повишени нива на NO след отстраняването на интерфейсната единица на субекта. Механизмът за промиване може да бъде свързан с източника на NO газ, така че потребителят да може да замени източника на gNO, използван за третиране с източник на газ с по-ниска концентрация на NO и по-висока концентрация на кислород (напр. цилиндър с сгъстен околен въздух или чист кислород). В някои аспекти, потребителят може след това да активира механизма за промиване, за да измести по-рано администрирания gNO от субекта на интерфейсния модул. Механизмът за промиване може да бъде изпълнен съгласно предписан протокол, например промиващият газ може да бъде администриран за определен период от време, докато интерфейсното устройство на субекта все още е прикрепено към субекта. В някои аспекти механизмът за промиване може да включва инжектиране на болус въздух или пречистен кислород в устройството за доставяне скоро след приключване на лечението с gNO. При този начин на работа няма значителна нужда от протокол за промиване, тъй като болусът въздух ще се инжектира и преминава през устройството за доставяне бързо. Други протоколи за промиване могат да се използват в съответствие с приетите медицински стандарти и практики, както би било признато от специалист в областта на техниката въз основа на настоящото разкритие.

Изпълнения на системите за доставяне на NO от настоящото разкритие могат да бъдат използвани за облекчаване на болестни симптоми или здравословни състояния и подобряване на терапевтичните резултати при субект по отношение на рани. Например, системите за доставяне на NO от настоящото разкритие могат да бъдат използвани за лечение на субекти със здравословни състояния, например захарен диабет, тъй като е известно, че тези субекти са изложени на риск от развитие на остри, както и хронични дермални язви (например, язви на краката ), при наличие на установени дълготрайни усложнения на здравословното състояние или заболяване. Инфекциите, дължащи се на диабетни язви, могат да варират по тежест от повърхностна паронихия до дълбоки инфекции, включващи костите. Тук се предвижда, че всеки и всички от тези видове язви могат да бъдат лекувани, като се използват системи и методи от настоящото разкритие. В определени изпълнения, видовете инфекции могат да включват, но не се ограничават до целулит, миозит, абсцеси, некротизиращ фасциит, септичен артрит, тендинит и остеомиелит.

Освен това, изпълнения на системите за доставяне на NO от настоящото разкритие могат да бъдат използвани за лечение на инфекции на кожата и меките тъкани (SSTI). SSTI са често срещани и сложните SSTI (cSSTI) могат да бъдат по-крайният край на това индикация. SSTI могат да обхващат редица клинични прояви, включително, но не само, дълбока инфекция, която обикновено изисква хирургична интервенция, наличие на системни признаци на сепсис, наличие на усложняващи съпътстващи заболявания, придружаващи неутропения, придружаваща исхемия, тъканна некроза , изгаряния и ухапвания. Стафилококус ауреус е най-честата причина за SSTI обаче, нейната епидемиология (например щамове причинители) и чувствителността към антибиотици в момента не могат да бъдат точно предвидени. Предполага се, че системите и методите, разкрити тук, могат да се използват за намаляване на риска от SSTI, както и за тяхното лечение.

Различни изпълнения на системите за доставяне на NO, разкрити в настоящата заявка, могат да осигурят средства за минимизиране на инфекцията чрез намаляване на биологичното натоварване, като се използва gNO под налягане, доставен до мястото на раната. За разлика от свързаните с антибиотици лечения срещу патогенни организми като бактерии, бактериите не са в състояние да развият резистентност към gNO. Следователно, системите за доставяне на NO от настоящото разкритие представляват универсално ефективно средство за лечение и/или предотвратяване на инфекции чрез намаляване на бионатоварването в раната и ускоряване на заздравяването. Изпълнения на настоящото приложение по отношение на системите за доставяне на NO могат да бъдат използвани за намаляване на инфекции, които вече присъстват в субекта, и/или използвани профилактично за предотвратяване на развитието на патогенна инфекция, например чрез прилагане на мястото на хирургична рана или разрез. В допълнение, gNO, доставен с помощта на системите и устройствата от настоящото разкритие, може да се използва за лечение на инфекция в широк спектър от рани и индикации за заболяване при субект, включително, но не само, места на патогенни инфекции като бактериални инфекции, гъбични инфекции , вирусни инфекции, протозойни инфекции, изгаряния, рани, бръчки, лезии и други подобни. Лезиите могат да включват, но не се ограничават до хирургична рана, рана от травма, изгаряне, абсцес, актинична кератоза, келоид, белег и рак на кожата и комбинация от тях.

В допълнение, изпълненията на настоящото разкритие по отношение на системите за доставяне на NO включват употреби в комбинация с други терапии за облекчаване на симптомите на заболяването и подобряване на терапевтичните резултати при субект, нуждаещ се от такова лечение. Например, в случай на остеомиелит, прилагането на NO съгласно изпълненията на настоящото разкритие може да се комбинира с други известни методи на лечение, включително, но не само, прилагане на антибиотици, хипербарна кислородна терапия (HBO), терапия за отстраняване на червеи и колония на гранулоцити -прилагане на стимулиращ фактор. В някои аспекти, комбинаторната терапия може да има синергични ефекти и може да изключи необходимостта от по-сериозна хирургична интервенция, като ампутация.

Примери на настоящото разкритие са включени, за да демонстрират определени изпълнения, представени тук. Специалистите в областта трябва да оценят, че техниките, разкрити в примерите, които следват, представляват техники, за които е установено, че функционират добре в практиките, разкрити тук. Въпреки това, специалистите в областта трябва, в светлината на настоящото разкритие, да оценят, че много промени могат да бъдат направени в определени изпълнения, които са разкрити и все пак да получат подобен или подобен резултат, без да се отклонява от духа и обхвата тук.

ФИГ. 4 е графика, илюстрираща ефектите от третирането с NO върху биологичното натоварване, използвайки анализ на инфекция, след три часа от инфекция, съгласно едно изпълнение на настоящото разкритие. Кожни проби, заразени за 3 часа с стафилокок, MRSA, Acinetobacter или Pseudomonas и след това се излага на 1% gNO при 1 ATM (14.695 psi) за 90 минути при скорост на потока от 0.1 литра/минута. Стафилококус ауреус, подвид aureus Rosenbach (ATCC#12600) Стафилококус ауреус, подвид aureus Rosenbach (ATCC#33591), устойчив на метицилин щам на Стафилококус ауреус, фаг тип 92 Acinetobacter baumannii (ATCC# BAA-747) и Pseudomonas aeruginosa (ATTC# BAA-47). Контрола = инфектирана, нетретирана тъкан. Бяха извършени три комплекта от три екземпляра на експеримент.

Както е илюстрирано на фиг. 4, третирането, което включва 1% gNO при 1 ATM (14,695 psi) за 90 минути значително намалява бионатоварването във всеки от четирите тествани типа бактерии. S. aureus е намален 5 пъти, а другите бактериални щамове са почти напълно унищожени. Тези резултати демонстрират ефикасността на прилагането на NO за намаляване на инфекцията чрез намаляване на бионатоварването в раната на субект. Освен това, тъй като тези експерименти са проведени с използване на модел на остра 3-часова инфекция, тези данни също показват, че лечението с NO съгласно горните терапевтични параметри може да се използва за предотвратяване на инфекции, както и за лечение на инфекции.

Намаляване на бионатоварването при налягания под 1,0 ATM

Проведени са също експерименти за определяне на способността за намаляване на инфекцията при прилагане на gNO при различни налягания под 1,0 ATM (14,695 psi) (независимо и в допълнение към налягането, приложено от външната среда), като се използва както устройство за клетъчна тъканна култура на Franz (т.е. 3-Ring) и преносимо NO доставящо устройство (т.е. Устройство за крака). Резултатите от един набор от експерименти са илюстрирани по-долу в Таблица 1. NO се прилага в концентрация от 1% след 24 часа от инфекцията с S. aureus. Скоростите на потока (cm 3 /min или cc) варират от около 100 до около 1500, потокът на прочистване (литри/мин или LPM) варира от около 0,1 до около 1,5, а времето на експозиция на NO варира между около 45 минути до около 105 минути сред различни лечебни групи и контроли. Преброяването на колониите (log CFU) се извършва при различни разреждания, които са представени в последните осем колони, обозначени с 0, 1×10 -1 до 1×10 -7 („0“ показва липса на разреждане). Резултатите в Таблица 1 показват, че бионатоварването е значително намалено (т.е. пълно убиване) след прилагане на NO при налягания от около 0,15 ATM (2,2 psi) за времена на експозиция от около 105 минути.

Освен това бяха проведени МТТ анализи за оценка на клетъчната жизнеспособност след прилагане на NO. MTT анализите са колориметрични анализи, използвани за оценка на жизнеспособността на клетките като функция на цветовата вариация. Както е илюстрирано по-долу в Таблица 2, клетъчната жизнеспособност след прилагане на NO под налягане при около 0,15 ATM (2,2 psi) за около 105 минути варира от около 40%-50%. Следователно, прилагането на NO при налягане под 1,0 ATM (14,695 psi) е ефективно за намаляване на биологичното натоварване и не компрометира значително клетъчната жизнеспособност.

Резултатите в таблици 2 и 3 показват, че NO може да се доставя при налягания под 1,0 ATM (14,695 psi) (независимо и в допълнение към налягането, приложено от външната среда) и ефективно да намали инфекцията чрез намаляване на биологичното натоварване, без значително да компрометира здравето на клетките на субекта. Използването на налягания под 1,0 ATM (14,695 psi) има допълнителната полза от изискването на по-малко външно налягане върху обекта на интерфейсния модул за поддържане на уплътнението, като по този начин прави уплътнението по-лесно за поставяне и поддържане, както и осигурява по-голяма степен на комфорт за предметът. Постигането на баланса между доставянето на NO при достатъчно високо налягане за намаляване на биологичното натоварване и същевременно поддържането на ефективно запечатване по темата е един важен принос на настоящото разкритие.

ФИГ. 5A-5C са представителни хистологични срезове, оцветени за откриване на присъствието на бактериите S. aureus върху третирана и нетретирана кожна проба тъкан, съгласно едно изпълнение на настоящото разкритие. ФИГ. 5А е взета от тъкан, която е била наранена, но оставена неинфектирана. ФИГ. 5В беше взета от тъкан, която беше наранена и инфектирана за 3 часа с S. aureus. ФИГ. 5С беше взето от тъкан, която беше наранена и инфектирана за 24 часа с S. aureus. Представителните хистологични срезове бяха оцветени с Giesma, което идентифицира S. aureus бактерии, присъстващи в тъканта на кожната проба. S. aureus бактериите могат да се видят на повърхността на раната след 3 часа от инфекцията, но до 24 часа от инфекцията бактериите се инфилтрират по-нататък в тъканта.

Откриване Производство на биофилм от оф S. aureus при кожни инфекции

Биофилмите могат да играят роля в хистопатологията и са сложни структури, състоящи се от бактериални клетки, вградени в извънклетъчен матрикс, който съдържа полизахариди, протеини и ДНК. Биофилмовата матрица може да ограничи ефективността на локалното антибиотично лечение при инфектирани рани и може да попречи на заздравяването на рани и имунните реакции. Различните компоненти на биофилма и свързания извънклетъчен матрикс могат да бъдат визуализирани с помощта на хистологични техники и могат да осигурят основа за оценка на ефикасността на прилагане на NO за намаляване на бионатоварването за бактерии, които образуват биофилми.

ФИГ. 6A-6F са представителни хистологични срезове, оцветени за откриване на компоненти на бактериален биофилм, съгласно едно изпълнение на настоящото разкритие. Кожните проби, използвани на фиг. 6A-6F бяха инфектирани за 24 часа с S. aureus бактерии, след това фиксирани във формалин, вградени и нарязани на стъпки от 5-6 μm. ФИГ. 6А беше взета от тъкан, оцветена с хематоксилин и еозин. ФИГ. 6В е взета от тъкан, оцветена с Feulgen реакция. ФИГ. 6С беше взета от тъкан, оцветена с модифицирано конго червено. ФИГ. 6D е взета от тъкан, оцветена с модифицирано конго червено с карбол фуксин. ФИГ. 6Е се взема от тъкан, оцветена с PAS. ФИГ. 6F се оцветява с Calcofluor. Използвайки тези хистологични техники, може да се вземе проба от кожна тъкан преди и след третиране с NO под налягане, за да се определи намаляването на бионатоварването на бактериите, които образуват биофилм.

Настоящото разкритие, в различни аспекти, изпълнения и конфигурации, включва компоненти, методи, процеси, системи и/или апарати по същество, както са изобразени и описани тук, включително различни аспекти, изпълнения, конфигурации, подкомбинации и подгрупи от тях. Специалистите в областта ще разберат как да направят и използват различните аспекти, аспекти, изпълнения и конфигурации, след като разберат настоящото разкритие. Настоящото разкритие, в различни аспекти, изпълнения и конфигурации, включва предоставяне на устройства и процеси при липса на елементи, които не са изобразени и/или описани тук или в различни аспекти, изпълнения и конфигурации тук, включително при липса на такива елементи, които могат са били използвани в предишни устройства или процеси, например за подобряване на производителността, постигане на лекота и/или намаляване на разходите за внедряване.

Горното обсъждане на разкритието е представено с цел илюстрация и описание. Горното не е предназначено да ограничи разкриването до формата или формите, разкрити тук. В предходното подробно описание например, различни характеристики на разкритието са групирани заедно в един или повече аспекти, изпълнения и конфигурации с цел рационализиране на разкритието. Характеристиките на аспектите, изпълненията и конфигурациите на разкритието могат да бъдат комбинирани в алтернативни аспекти, изпълнения и конфигурации, различни от тези, обсъдени по-горе. Този метод на разкриване не трябва да се тълкува като отразяващ намерението, че заявеното разкриване изисква повече характеристики, отколкото са изрично посочени във всяка претенция. По-скоро, както отразяват следващите претенции, изобретателските аспекти се крият в по-малко от всички характеристики на единични по-горе разкрити аспекти, изпълнения и конфигурации. По този начин следните претенции са включени в това подробно описание, като всяка претенция стои самостоятелно като отделно предпочитано изпълнение на разкритието.

Освен това, въпреки че описанието на разкритието включва описание на един или повече аспекти, изпълнения или конфигурации и определени вариации и модификации, други вариации, комбинации и модификации са в обхвата на разкритието, например, както може да бъде в рамките на умението и познаване на тези в областта, след разбиране на настоящото разкритие. Предназначено е да получи права, които включват алтернативни аспекти, изпълнения и конфигурации, доколкото е позволено, включително алтернативни, взаимозаменяеми и/или еквивалентни структури, функции, диапазони или стъпки спрямо заявените, независимо дали такива алтернативни, взаимозаменяеми и/или еквивалентни структурите, функциите, обхватите или стъпките са разкрити тук и без намерение за публично посвещаване на патентоспособен предмет.


Претенции

1. Метод за лечение на лечение на рак, включващ:

интратуморно прилагане на терапевтично ефективна доза от ваксина на субект, който се нуждае от това.

2. Метод съгласно претенция 1, където ваксината е моновалентна или многовалентна ваксина.

3. Метод съгласно претенция 1, характеризиращ се с това, че ваксината е ваксина срещу грип.

4. Метод съгласно претенция 3, където грипната ваксина е сезонна грипна ваксина.

5. Метод съгласно претенция 1, характеризиращ се с това, че ваксината е избрана от групата, състояща се от DTaP (дифтерия, коклюш и тетанус), Pneumovax (пневмококова пневмония), HepB (хепатит В) и MMR (морбили, паротит, рубеола).

6. Метод съгласно претенция 1, характеризиращ се с това, че противогрипната ваксина е одобрена от FDA ваксина.

7. Метод съгласно претенция 1, характеризиращ се с това, че се прилагат множество дози от ваксината.

8. Метод съгласно претенция 1, характеризиращ се с това, че интратуморното приложение е чрез инжектиране или по време на процедура на биопсия.

9. Метод съгласно претенция 1, характеризиращ се с това, че ваксината е инактивирана.

10. Метод съгласно претенция 1, характеризиращ се с това, че ваксината е без адювант.

11. Метод съгласно претенция 1, при който ракът е избран от групата, състояща се от меланом, недребноклетъчен бял дроб, дребноклетъчен бял дроб, бял дроб, хепатокарцином, ретинобластом, астроцитом, глиобластом, левкемия, невробластом, глава, шия, гърда, панкреаса, простата, бъбреци, кости, тестиси, яйчници, мезотелиом, шийка на матката, стомашно-чревен тракт, урогенитални, дихателни пътища, хемопоетични, мускулно-скелетни, невроендокринни, карцином, сарком, централна нервна система, периферна нервна система, мозъчен дерматит, лимфа на мозъка рак.

12.2. Метод съгласно претенция 1, допълнително включващ прилагане на поне едно допълнително противораково лечение.

13. Методът съгласно претенция 12, където поне едно допълнително противораково лечение е хирургична терапия, химиотерапия, лъчева терапия, хормонална терапия, имунотерапия, терапия с малки молекули, терапия с инхибитор на рецепторна киназа, антиангиогенна терапия, цитокинова терапия, криотерапия, радиоаблация или биологична терапия.

14. Метод съгласно претенция 12, където поне едно допълнително противораково лечение е инхибитор на имунната контролна точка.

15. Метод съгласно претенция 14, при който най-малко един инхибитор на контролна точка е избран от инхибитор на програмирана Т клетъчна смърт 1 (PD-1), програмиран лиганд на Т клетъчна смърт 1 (PD-L1), PDL-2, цитотоксичен Т -лимфоцитен антиген 4 (CTLA-4), ген за активиране на лимфоцити 3 (LAG-3), Tim-3, CD28, CD122 или CD137.

16. Метод съгласно претенция 15, където най-малко един инхибитор на контролна точка е анти-PD-1 антитяло, анти-PD-L1 антитяло, анти-PD-L2 антитяло, анти-CTLA4 антитяло или анти-LAG3 антитяло.

17. Метод съгласно претенция 16, където анти-PD-1 антитялото е избрано от групата, състояща се от ниволумаб, пембролизумаб, пидилизумаб, AMP-514, REGN2810, CT-011, BMS 936559, MPDL3280A и AMP-224, където анти-PD-L1 антитялото е избрано от групата, състояща се от дурвалумаб, атезолизумаб и авелумаб и където анти-CTLA-4 антитялото е тремелимумаб или ипилимумаб.

18. Метод съгласно претенция 14, при който се прилага повече от един инхибитор на контролна точка.

19. Метод за повишаване на имунния отговор при тумор, методът включва:

интратуморно прилагане на терапевтично ефективна доза от грипна ваксина на субект, нуждаещ се от това.

20. Методът съгласно претенция 19, характеризиращ се с това, че противогрипната ваксина е не-В-клетъчна промотираща ваксина.


Препратки

Matteucci, M. D. & amp Caruthers, M. H. Синтез на деоксиолигонуклеотиди върху полимерна подложка. J. Am. Chem. Soc. 103, 3185–3191 (1981).

Saiki, R.K. et al. Праймер-насочена ензимна амплификация на ДНК с термостабилна ДНК полимераза. наука 239, 487–491 (1988).

Hutchison, C.A. et al. Мутагенеза в специфична позиция в ДНК последователност. J. Biol. Chem. 253, 6551–6560 (1978).

Heim, R. & Tsien, R. Y. Инженеринг на зелен флуоресцентен протеин за подобрена яркост, по-дълги дължини на вълната и флуоресцентен резонансен пренос на енергия. Curr. Biol. 6, 178–182 (1996).

Barbas, C.F., Kang, A.S., Lerner, R.A. & Benkovic, S.J. Сглобяване на библиотеки от комбинаторни антитела върху фагови повърхности: мястото на ген III. Proc. Натл акад. Sci. САЩ 88, 7978–7982 (1991).

Wang, L., Brock, A., Herberich, B. & amp Schultz, P.G. Разширяване на генетичния код на Escherichia coli. наука 292, 498–500 (2001).

Lerner, R.A., Benkovic, S.J. & Schultz, P.G. На кръстопътя на химията и имунологията: каталитични антитела. наука 252, 659–667 (1991).

Siegel, J. B. et al. Изчислителен дизайн на ензимен катализатор за стереоселективна бимолекулярна реакция на Diels-Alder. наука 329, 309–313 (2010).

Wang, L. et al. Синтетична геномика: от синтеза на ДНК до дизайна на генома. Angew. Chem. Int. Изд. 57, 1748–1756 (2018).

Gibson, D.G. et al. Създаване на бактериална клетка, контролирана от химически синтезиран геном. наука 329, 52–56 (2010).

Annaluru, N. et al. Пълен синтез на функционална дизайнерска еукариотна хромозома. наука 344, 55–58 (2014).

Налдини, Л. Генната терапия се връща на централно място. природата 526, 351–360 (2015).

Dunbar, C.E. et al. Генната терапия навършва пълнолетие. наука 359, eaan4672 (2018).

Sheridan, C. Генната терапия намира своята ниша. Нац. Биотехнология. 29, 121–128 (2011).

Дженкс, С. Генна терапия смърт – „всеки трябва да споделя вината си”. J. Natl Cancer Inst. 92, 98–100 (2000).

Wang, T., Upponi, J. R. & amp Torchilin, V. P. Проектиране на многофункционални невирусни генни вектори за преодоляване на физиологичните бариери: дилеми и стратегии. Int. J. Pharm. 427, 3–20 (2012).

Джулиано, R.L. Доставката на терапевтични олигонуклеотиди. Нуклеинови киселини Res. 44, 6518–6548 (2016).

Yin, H. et al. Невирусни вектори за генно-базирана терапия. Нац. Преподобният Жене. 15, 541–555 (2014).

Hill, A. B., Chen, M., Chen, C. K., Pfeifer, B. A. & amp Jones, C. H. Преодоляване на пречките за доставка на гени: физиологични съображения за невирусни вектори. Тенденции Biotechnol. 34, 91–105 (2016).

Giacca, M. & Zacchigna, S. Вирус-медиирана генна доставка за човешка генна терапия. J. Контрол. Освободете 161, 377–388 (2012).

Merten, O.W. & Gaillet, B. Вирусни вектори за генна терапия и подходи за генна модификация. Biochem. инж. Дж. 108, 98–115 (2016).

Melchiorri, D. et al. Регулаторна оценка на Glybera в Европа — два комитета, една мисия. Нац. Rev. Drug Discov. 12, 719 (2013).

Peng, Z. Текущо състояние на гендицината в Китай: рекомбинантен човешки Ad-p53 агент за лечение на рак. Хъм Джийн Тер. 16, 1016–1027 (2005).

Russell, S. et al. Ефикасност и безопасност на voretigene neparvovec (AAV2-hRPE65v2) при пациенти с RPE65-медиирана наследствена дистрофия на ретината: рандомизирано, контролирано, открито, фаза 3 проучване. Ланцет 390, 849–860 (2017).

Кайзер, Дж. Втори шанс. наука 358, 582–585 (2017).

Старши, М. След оттеглянето на Glybera, какво следва за генната терапия? Нац. Биотехнология. 35, 491–492 (2017).

Хадж, К. А. и Уайтхед, К. А. Инструменти за превод: невирусни материали за терапевтично доставяне на иРНК. Нац. Преподобни Матер. 2, 17056 (2017).

Kaczmarek, J.C., Kowalski, P.S. & Anderson, D.G. Напредък в доставянето на РНК терапевтични средства: от концепция до клинична реалност. Genome Med. 9, 60 (2017).

Reichmuth, A.M., Oberli, M.A., Jaklenec, A., Langer, R. & Blankschtein, D. Доставяне на ваксина с тРНК с помощта на липидни наночастици. Тер. Deliv. 7, 319–334 (2016).

Стантън, М. Г. Текущо състояние на системите за доставяне на информационна РНК. Нуклеинова киселина. Тер. 28, 158–165 (2018).

Hartung, T. & Daston, G. Подходящи ли са in vitro тестовете за регулаторна употреба? Токсикол. Sci. 111, 233–237 (2009).

Khvorova, A. & amp Watts, J.K. Химичната еволюция на олигонуклеотидните терапии от клинична полза. Нац. Биотехнология. 35, 238–248 (2017). Този преглед предоставя изчерпателен преглед на химическите модификации на олигонуклеотиди от медицински интерес.

Kumar, S. R., Markusic, D. M., Biswas, M., High, K. A. & amp Herzog, R. W. Клинично развитие на генната терапия: резултати и уроци от последните успехи. Mol. Тер. Методи Clin. Разв. 3, 16034 (2016).

Ginn, S. L., Amaya, A. K., Alexander, I. E., Edelstein, M. & amp Abedi, M. R. Клинични проучвания за генна терапия в световен мащаб до 2017 г.: актуализация. J. Gene Med. 20, e3015 (2018).

Stein, C. A. & amp Castanotto, D. Одобрени от FDA олигонуклеотидни терапии през 2017 г. Mol. Тер. 25, 1069–1075 (2017).

Zuckerman, J. E. & amp Davis, M. E. Клиничен опит със системно прилагани терапевтични средства, базирани на siRNA при рак. Нац. Rev. Drug Discov. 14, 843–856 (2015).

Barata, P., Sood, A.K. & Hong, D.S. РНК-насочени терапевтични средства в клинични изпитвания на рак: текущо състояние и бъдещи насоки. Лечение на рак. Rev. 50, 35–47 (2016).

Adams, D. et al. Patisiran, RNAi терапевтично средство за наследствена транстиретинова амилоидоза. N. Engl. J. Med. 379, 11–21 (2018).

Stein, C.A. et al. Ефективно генно заглушаване чрез доставяне на заключени антисенс олигонуклеотиди на нуклеинова киселина, без помощ от реагенти за трансфекция. Нуклеинови киселини Res. 38, e3 (2010).

Goyenvalle, A. et al. Функционална корекция при миши модели на мускулна дистрофия, използвайки трицикло-ДНК олигомери, прескачащи екзон. Нац. Мед. 21, 270–275 (2015).

Geary, R. S., Baker, B. F. & Crooke, S. T. Клинична и предклинична фармакокинетика и фармакодинамика на mipomersen (Kynamro®): второ поколение антисенс олигонуклеотиден инхибитор на аполипопротеин В. Clin. Фармакокинет. 54, 133–146 (2015).

Souleimanian, N. et al. Антисенс 2'-дезокси, 2'-флуороарабино нуклеинова киселина (2'F-ANA) олигонуклеотиди: in vitro гимнотични заглушители на генна експресия, чиято сила се засилва от мастни киселини. Mol. Тер. Нуклеинова киселина 1, e43 (2012).

Azad, R. F., Brown-Driver, V., Buckheit, R. W. & amp Anderson, K. P. Антивирусна активност на фосфоротиоат олигонуклеотид, комплементарен на човешкия цитомегаловирусна РНК, когато се използва в комбинация с антивирусни нуклеозидни аналози. Антивирусна Рез. 28, 101–111 (1995).

Chi, X., Gatti, P. & Papoian, T. Безопасност на антисенс олигонуклеотид и siRNA-базирани терапевтични средства. Наркотикът Discov. днес 22, 823–833 (2017).

Shen, W. et al. Острата хепатотоксичност на 2' флуор-модифицирани 5-10-5 гапмер фосфоротиоатни олигонуклеотиди при мишки корелира с вътреклетъчното свързване с протеини и загубата на DBHS протеини. Нуклеинови киселини Res. 46, 2204–2217 (2018).

Burdick, A.D. et al. Мотиви на последователността, свързани с хепатотоксичност на заключена нуклеинова киселина - модифицирани антисенс олигонуклеотиди. Нуклеинови киселини Res. 42, 4882–4891 (2014).

Fuertes, A., Juanes, M., Granja, J. R. & amp Montenegro, J. Супрамолекулни функционални сглобки: динамични мембранни транспортери и пептидни нанотръбни композити. Chem. комун. 53, 7861–7871 (2017).

Meade, B.R. et al. Ефективно доставяне на RNAi пролекарства, съдържащи обратими модификации на гръбнака на фосфотриестер, неутрализиращи заряда. Нац. Биотехнология. 32, 1256–1261 (2014). Това изследване представя метод за ефективно производство на производни на фосфотриестерни нуклеинови киселини, които имат отлични свойства за насочване и доставяне.

McNamara, J.O. et al. Специфично за клетъчен тип доставка на siRNAs с аптамер-siRNA химери. Нац. Биотехнология. 24, 1005–1015 (2006).

Shu, D. et al. Системно доставяне на анти-miRNA за потискане на тройно отрицателен рак на гърдата, използвайки РНК нанотехнология. ACS Nano 9, 9731–9740 (2015).

Ren, K. et al. Стратегия с двойно заключване и ключ за ДНК за специфична за клетъчен подтип доставка на siRNA. Нац. комун. 7, 13580 (2016).

Schmidt, K. et al. Характеризиране на ефекта на GalNAc и фосфоротиоатния гръбнак върху свързването на антисенс олигонуклеотиди към асиалогликопротеиновия рецептор. Нуклеинови киселини Res. 45, 2294–2306 (2017).

Tanowitz, M. et al. Азиалогликопротеинов рецептор 1 медиира продуктивното поглъщане на N-ацетилгалактозамин-конюгирани и неконюгирани фосфоротиоатни антисенс олигонуклеотиди в чернодробните хепатоцити. Нуклеинови киселини Res. 45, 12388–12400 (2017).

Златев, И. и др. Обръщане на siRNA-медиирано генно заглушаване in vivo. Нац. Биотехнология. 36, 509–511 (2018).

Huang, Y. Предклинични и клинични постижения на GalNAc-декорирани терапевтични средства с нуклеинова киселина. Mol. Тер. Нуклеинова киселина 6, 116–132 (2017).

Lu, X. et al. Ефективно регулиране на антисенс ген чрез некатионни четки от полиетилен гликол. J. Am. Chem. Soc. 138, 9097–9100 (2016).

Jia, F. et al. Профилиране в дълбочина на стабилността на нуклеазата и ефикасността на заглушаване на гена на конюгати от поли(етиленгликол)-ДНК с архитектура с четка. J. Am. Chem. Soc. 139, 10605–10608 (2017).

Jin, Y. et al. Биоразградими, многофункционални наноцветя DNAzyme за подобрена терапия на рак. NPG Asia Mater. 9, e365 (2017).

Lee, J.H. et al. Полимерни siRNA наночастици, базирани на транскрипция с въртящ кръг, за доставка, насочена към тумор. J. Контрол. Освободете 263, 29–38 (2017).

Rozema, D.B. et al. Средства за доставка на siRNA, задействани от протеаза. J. Контрол. Освободете 209, 57–66 (2015).

Lee, K. et al. In vivo доставка на транскрипционни фактори с многофункционални олигонуклеотиди. Нац. Матер. 14, 701–706 (2015). Тази статия представя процедура за доставяне на транскрипционни фактори in vivo с помощта на олигонуклеотиди, които са модифицирани с рН-реагиращи конструкции.

McCaffrey, J., Donnelly, R.F. & amp McCarthy, H.O. Microneedles: иновативна платформа за доставка на гени. Drug Deliv. Transl Res. 5, 424–437 (2015).

Suda, T. & Liu, D. Хидродинамично генно доставяне: неговите принципи и приложения. Mol. Тер. 15, 2063–2069 (2007).

Stewart, M. P. et al. In vitro и ex vivo стратегии за вътреклетъчна доставка. природата 538, 183–192 (2016).

Джаксън, H. J., Rafiq, S. & Brentjens, R. J. Движение на CAR T клетки напред. Нац. преп. Клин. Oncol. 13, 370–383 (2016).

Ding, X. et al. Високопроизводителна ядрена доставка и бърза експресия на ДНК чрез механично и електрическо разрушаване на клетъчната мембрана. Нац. Biomed. инж. 1, 0039 (2017).

Chiappini, C. et al. Биоразградими силициеви наноигли, доставящи нуклеинови киселини вътреклетъчно, индуцират локализирана in vivo неоваскуларизация. Нац. Матер. 14, 532–539 (2015).

Anderson, C. D., Moisyadi, S., Avelar, A., Walton, C. B. & amp Shohet, R. V. Ултразвуково насочено чернодробно доставяне на фактор IX при хемофилични мишки. Джийн Тер. 23, 510–519 (2016).

Manta, S. et al. Катионни микромехурчета и миниплазмид без антибиотици за продължителна ултразвуково медиирана трансгенна експресия в черния дроб. J. Контрол. Освободете 262, 170–181 (2017).

Chertok, B., Langer, R.S. & Anderson, D.G. Пространствен контрол на генната експресия от наноносители, използвайки хепарин маскиране и ултразвуково насочено разрушаване на микромехурчета. ACS Nano 10, 7267–7278 (2016).

Yoon, S., Wang, P., Peng, Q., Wang, Y. & Shung, K.K. Акустична трансфекция за геномна манипулация на единични клетки с помощта на високочестотен ултразвук. Sci. представител 7, 5275 (2017).

Pastuzyn, E.D. et al. Невроналният ген Arc кодира пренасочен ретротранспозон Gag протеин, който медиира междуклетъчния трансфер на РНК. клетка 172, 275 (2018).

Chen, L.S. et al. Ефективен генен трансфер, използващ частица, подобна на човешки JC вирус, която инхибира растежа на човешкия аденокарцином на дебелото черво в модел на гола мишка. Джийн Тер. 17, 1033–1041 (2010).

Lee, P.W. et al. Полимерната структура и конформация променят антигенността на вирусоподобните частици-полимерни конюгати. J. Am. Chem. Soc. 139, 3312–3315 (2017).

Zackova Suchanova, J., Neburkova, J., Spanielova, H., Forstova, J. & Cigler, P. Пренасочване на полиомавирусоподобни частици към ракови клетки чрез химическа модификация на повърхността на капсида. Биоконюг. Chem. 28, 307–313 (2017).

Tong, G.J., Hsiao, S.C., Carrico, Z.M. & Francis, M.B. Вирусни капсидни ДНК аптамерни конюгати като мултивалентни носители, насочени към клетки. J. Am. Chem. Soc. 131, 11174–11178 (2009).

Eguchi, A. et al. Ефективно доставяне на siRNA в първичните клетки чрез слят протеин на пептиден трансдукционен домен-dsRNA свързващ домен (PTD-DRBD). Нац. Биотехнология. 27, 567–571 (2009).

Yang, N.J. et al. Цитозолно доставяне на siRNA чрез dsRNA свързващи протеини с ултра висок афинитет. Нуклеинови киселини Res. 45, 7602–7614 (2017).

Bienk, K. et al. Албумин-медиирана холестеролна базирана стратегия за настройка на фармакокинетиката на siRNA и заглушаване на гените. J. Контрол. Освободете 232, 143–151 (2016).

Sarett, S.M. et al. Липофилната siRNA се насочва към албумина in situ и насърчава бионаличността, проникването на тумора и заглушаването на гена без носител. Proc. Натл акад. Sci. САЩ 114, E6490–E6497 (2017).

Hvam, M.L. et al. Модифицирани с мастни киселини гапмер антисенс олигонуклеотид и серумен албумин конструкции за фармакокинетична модулация. Mol. Тер. 25, 1710–1717 (2017).

Song, E. et al. Антитяло, медиирано in vivo, доставяне на малки интерфериращи РНК чрез рецептори на клетъчната повърхност. Нац. Биотехнология. 23, 709–717 (2005).

Cuellar, T.L. et al. Систематична оценка на медиираната от антитяло siRNA доставка с помощта на индустриална платформа от конюгати на THIOMAB-siRNA. Нуклеинови киселини Res. 43, 1189–1203 (2015).

Lehto, T., Ezzat, K., Wood, M.J.A. & amp El Andaloussi, S. Пептиди за доставяне на нуклеинова киселина. адв. Drug Deliv. Rev. 106, 172–182 (2016).

Tai, W. & Gao, X. Функционални пептиди за доставка на siRNA. адв. Drug Deliv. Rev. 110–111, 157–168 (2017).

Hammond, S.M. et al. Системната пептидно-медиирана олигонуклеотидна терапия подобрява дългосрочната преживяемост при спинална мускулна атрофия. Proc. Натл акад. Sci. САЩ 113, 10962–10967 (2016).

Echigoya, Y. et al. Ефекти от системно пропускане на мултиекзон с пептид-конюгирани морфолини в сърцето на кучешки модел на мускулна дистрофия на Дюшен. Proc. Натл акад. Sci. САЩ 114, 4213–4218 (2017).

Медина, S.H. et al. Присъщо неуреден пептид улеснява навлизането на неендозомни клетки. Angew. Chem. Int. Изд. 55, 3369–3372 (2016).

Soudah, T., Mogilevsky, M., Karni, R. & Yavin, E. CLIP6-PNA-пептидни конюгати: неендозомна доставка на олигонуклеотиди за превключване на снаждане. Биоконюг. Chem. 28, 3036–3042 (2017).

Bulut, S. et al. Бавно освобождаване и доставяне на антисенс олигонуклеотидно лекарство от самостоятелно сглобени пептидни амфифилни нановлакна. Биомакромолекули 12, 3007–3014 (2011).

Mazza, M., Hadjidemetriou, M., de Lázaro, I., Bussy, C. & amp Kostarelos, K. Пептидни нановолакнести комплекси с siRNA за дълбоко заглушаване на мозъчни гени чрез стереотактична неврохирургия. ACS Nano 9, 1137–1149 (2015).

Йоламанова, М. и др. Пептидните нанофибрили засилват трансфера на ретровирусни гени и осигуряват бързо средство за концентриране на вируси. Нац. Нанотехнология. 8, 130–136 (2013).

Dai, B. et al. Регулируемо сглобяване на амилоид-образуващи пептиди в нанопластове като ретровирусен носител. Proc. Натл акад. Sci. САЩ 112, 2996–3001 (2015).

McCarthy, H.O. et al. Разработване и характеризиране на самосглобяващи се наночастици, използвайки био-инспириран амфипатичен пептид за доставяне на ген. J. Контрол. Освободете 189, 141–149 (2014).

Udhayakumar, V.K. et al. Богатите на аргинин пептид-базирани mRNA нанокомплекси ефективно стимулират цитотоксичния Т-клетъчен имунитет, зависим от амфипатичната организация на пептида. адв. здравен. Матер. 6, 1601412 (2017).

Douat, C. et al. Клетъчно проникващ фолдамер с биоредуцируема връзка за вътреклетъчно доставяне на ДНК. Angew. Chem. Int. Изд. 54, 11133–11137 (2015).

Gehin, C. et al. Динамични амфифилни библиотеки за скрининг за "ароматна" доставка на siRNA в HeLa клетки и човешки първични фибробласти. J. Am. Chem. Soc. 135, 9295–9298 (2013).

Louzao, I., García-Fandiño, R. & amp Montenegro, J. Хидразон-модулирани пептиди за ефективна генна трансфекция. J. Mater. Chem. Б 5, 4426–4434 (2017).

Lostalé-Seijo, I., Louzao, I., Juanes, M. & amp Montenegro, J. Peptide/Cas9 наноструктури за транспорт на рибонуклеопротеинова клетъчна мембрана и генно издание. Chem. Sci. 8, 7923–7931 (2017).

Li, М. и сътр. Включването на неестествен аналог на аргинин в цикличен пептид води до образуване на положително заредени нановлакна, способни на генна трансфекция. Angew. Chem. Int. Изд. 55, 598–601 (2016).

Li, M., Schlesiger, S., Knauer, S.K. & Schmuck, C. Специално изработен специфичен анион-свързващ мотив в страничната верига трансформира тетрапептид в ефективен вектор за доставяне на ген. Angew. Chem. Int. Изд. 54, 2941–2944 (2015). Тази статия представя новата гуанидиниокарбонилпиролна група за доставяне на нуклеинова киселина.

Montenegro, J., Ghadiri, M. R. & Granja, J. R. Модели на йонни канали, базирани на самосглобяващи се циклични пептидни нанотръби. Съгл. Chem. Рез. 46, 2955–2965 (2013).

Jana, P. et al. Ефективна генна трансфекция чрез инхибиране на образуването на β-лист (амилоидни влакна) на къс амфифилен пептид от златни наночастици. Angew. Chem. Int. Изд. 56, 8083–8088 (2017).

Freire, J.M. et al. siRNA-клетъчно-проникващи пептидни комплекси като комбинаторна терапия срещу хронична миелоидна левкемия, използвайки BV173 клетъчна линия като модел. J. Контрол. Освободете 245, 127–136 (2017).

Felgner, P.L. et al. Липофекция: високоефективна, липид-медиирана процедура за ДНК-трансфекция. Proc. Натл акад. Sci. САЩ 84, 7413–7417 (1987).

Алън, Т. М. и Кулис, П. Р. Липозомни системи за доставяне на лекарства: от концепция до клинични приложения. адв. Drug Deliv. Rev. 65, 36–48 (2013).

Oude Blenke, E. E., van den Dikkenberg, J., van Kolck, B., Kros, A. & amp Mastrobattista, E. Взаимодействия на навита намотка за насочване на липозоми за доставка на нуклеинова киселина. Наномащаб 8, 8955–8965 (2016).

Yang, J. et al. Доставяне на лекарството чрез сливане на клетъчна мембрана, използвайки липопептидно модифицирани липозоми. ACS Cent. Sci. 2, 621–630 (2016).

O’Brien, P. J., Elahipanah, S., Rogozhnikov, D. & amp Yousaf, M. N. Био-ортогонално медиирана трансфекция на нуклеинова киселина на клетки чрез инженерство на клетъчната повърхност. ACS Cent. Sci. 3, 489–500 (2017). Това изследване описва метод за прилагане на биоортогонална химия към сливането на липозоми.

Kauffman, K.J. et al. Оптимизиране на формулировки на липидни наночастици за доставяне на иРНК in vivo с фракционен факторен и окончателен дизайн на скрининг. Нано Лет. 15, 7300–7306 (2015).

Farhood, H., Serbina, N. & amp Huang, L. Ролята на диолеоил фосфатидилетаноламин в катионен липозомно медииран генен трансфер. Biochim. Биофиз. Acta 1235, 289–295 (1995).

Leal, C., Bouxsein, N.F., Ewert, K.K. & Safinya, C.R. Високоефективна генно заглушаваща активност на siRNA, вградена в наноструктурирана гироидна кубична липидна матрица. J. Am. Chem. Soc. 132, 16841–16847 (2010).

Kim, H. & Leal, C. Cuboplexes: топологично активно доставяне на siRNA. ACS Nano 9, 10214–10226 (2015).

Evers, M.J.W. et al.Най-съвременен дизайн и техники за бързо смесване на липидни наночастици за доставка на нуклеинова киселина. Малки методи. https://doi.org/10.1002/smtd.201700375 (2018).

Whitehead, K.A. et al. Разградими липидни наночастици с предсказуема in vivo активност на доставяне на siRNA. Нац. комун. 5, 4277 (2014).

Viricel, W. et al. Катионни превключващи се липиди: pH-задействан молекулен превключвател за доставка на siRNA. Наномащаб 9, 31–36 (2017).

Kranz, L.M. et al. Системното доставяне на РНК до дендритните клетки използва антивирусна защита за имунотерапия на рак. природата 534, 396–401 (2016).

Oberli, M.A. et al. Доставяне на иРНК, подпомагано от липидни наночастици за мощна имунотерапия на рак. Нано Лет. 17, 1326–1335 (2017).

Liang, C. et al. Функционализирани с аптамер липидни наночастици, насочени към остеобластите като нова костна анаболна стратегия, базирана на РНК интерференция. Нац. Мед. 21, 288–294 (2015).

Ripoll, M. et al. pH-отзивчивите нанометрични полидиацетиленови мицели позволяват ефективно вътреклетъчно доставяне на siRNA. ACS Appl. Матер. Интерфейси 8, 30665–30670 (2016).

Morin, E., Nothisen, M., Wagner, A. & Remy, J.S. Катионни полидиацетиленови мицели за доставяне на ген. Биоконюг. Chem. 22, 1916–1923 (2011).

Neuberg, P. et al. Полидиацетиленови нановлакна като нови носители на siRNA за in vitro и in vivo доставка. Наномащаб 10, 1587–1590 (2018).

Jayaraman, M. et al. Максимизиране на силата на siRNA липидни наночастици за заглушаване на чернодробния ген in vivo. Angew. Chem. Int. Изд. 51, 8529–8533 (2012).

Yim, N. et al. Екзозомно инженерство за ефективно вътреклетъчно доставяне на разтворими протеини, използвайки оптически обратим модул за взаимодействие протеин-протеин. Нац. комун. 7, 12277 (2016).

Lee, J. et al. Клетъчно инженерство с мембранни фузогенни липозоми за производство на функционализирани извънклетъчни везикули. ACS Appl. Матер. Интерфейси 8, 6790–6795 (2016). Това изследване описва универсален метод за химическа функционализация на екзозомите.

O’Loughlin, A.J. et al. Функционално доставяне на конюгирана с липиди siRNA чрез извънклетъчни везикули. Mol. Тер. 25, 1580–1587 (2017).

Didiot, M.C. et al. Екзозомно-медиирано доставяне на хидрофобно модифицирана siRNA за заглушаване на иРНК на Huntingtin. Mol. Тер. 24, 1836–1847 (2016).

Cui, Z.K. et al. Доставка на siRNA чрез катионни стерозоми за подобряване на остеогенната диференциация на мезенхимни стволови клетки. J. Контрол. Освободете 217, 42–52 (2015).

Wang, Y. et al. Стратегия, базирана на наночастици, за изобразяване на широк спектър от тумори чрез нелинейно усилване на сигнали от микросреда. Нац. Матер. 13, 204–212 (2014).

Xu, X. et al. Ултра-рН-отзивчива и проникваща в тумора наноплатформа за насочена доставка на siRNA със силна противоракова ефикасност. Angew. Chem. Int. Изд. 55, 7091–7094 (2016).

Xu, X. et al. Многофункционална платформа за доставяне на siRNA наночастици от плик за терапия на рак на простатата. ACS Nano 11, 2618–2627 (2017).

Zhou, J. et al. pH-чувствителни наномицели за високоефективно доставяне на siRNA in vitro и in vivo: поглед върху дизайна на поликатиони със силно цитозолно освобождаване. Нано Лет. 16, 6916–6923 (2016). Тази статия се фокусира върху свойствата на поликатионите, които са необходими за максимално цитозолно освобождаване на siRNA товари в условия на много ниско усвояване.

Chiper, M., Tounsi, N., Kole, R., Kichler, A. & amp Zuber, G. Самоагрегиращите се 1,8 kDa полиетиленимини с превключвател на разтваряне при ендозомно киселинно pH са носители за доставка на плазмидна ДНК, иРНК, siRNA и екзон- пропускане на олигонуклеотиди. J. Контрол. Освободете 246, 60–70 (2017).

Cheng, Y., Yumul, R.C. & Pun, S.H. Полимер, вдъхновен от вируса, за ефективно in vitro и in vivo доставяне на ген. Angew. Chem. Int. Изд. 55, 12013–12017 (2016).

Cheng, Y. et al. Разработване на сменяеми полимери за справяне с дилемата за стабилност и освобождаване на товара в носители на поликатионна нуклеинова киселина. Биоматериали 127, 89–96 (2017).

McKinlay, C. J. et al. Променящи заряда освобождаеми транспортери (CARTs) за доставяне и освобождаване на иРНК в живи животни. Proc. Натл акад. Sci. САЩ 114, E448–E456 (2017). Това проучване описва самозапалващ се полимер, който може да доставя иРНК в първични клетки и in vivo.

Chahal, J.S. et al. Наночастиците на дендример-РНК генерират защитен имунитет срещу смъртоносни предизвикателства с ебола, грип H1N1 и Toxoplasma gondii с една доза. Proc. Натл акад. Sci. САЩ 113, E4133–E4142 (2016).

Liu, S. et al. Биоредуцируем цинк(ii)-координативен полиетиленимин с ниско молекулно тегло за стабилно генно доставяне на първични и стволови клетки. J. Am. Chem. Soc. 139, 5102–5109 (2017).

Zou, Y. et al. Химерните полимерзоми, имитиращи вируси, засилват насочената сиРНК терапия на рак in vivo. адв. Матер. 29, 1703285 (2017).

Li, L. et al. Изкуственият вирус доставя CRISPR-Cas9 система за редактиране на генома на клетки в мишки. ACS Nano 11, 95–111 (2017).

Naito, M. et al. Функционализиран с фенилборонат полийонен комплекс мицел за АТФ-задействано освобождаване на siRNA. Angew. Chem. Int. Изд. 51, 10751–10755 (2012).

Naito, M. et al. Подобрено вътреклетъчно доставяне на siRNA чрез контролиране на ATP-чувствителността на функционализирани с фенилборна киселина полийонни комплексни мицели. Macromol. Biosci. 18, 1700357 (2018).

Yoshinaga, N. et al. Полиплексни мицели с фенилборонат/глюконамид омрежване в ядрото, упражняващо стимулирана генна трансфекция чрез пространствено-времева чувствителност към вътреклетъчно рН и концентрация на АТФ. J. Am. Chem. Soc. 139, 18567–18575 (2017).

Truong, N. P. et al. Полимерна система, вдъхновена от грипния вирус, за навременно освобождаване на siRNA. Нац. комун. 4, 1902 (2013).

Wang, M., Liu, H., Li, L. & Cheng, Y. Флуриран дендример постига отлична ефикасност на генна трансфекция при изключително ниско съотношение азот към фосфор. Нац. комун. 5, 3053 (2014).

Wang, H. et al. Самосглобените флуородендримери съчетават характеристиките на липидните и полимерните вектори при доставянето на гени. Angew. Chem. Int. Изд. 54, 11647–11651 (2015).

Wang, L. H., Wu, D. C., Xu, H. X. & amp You, Y. Z. Висок афинитет на свързване на ДНК и ефикасност на генна трансфекция на биоредуцируеми катионни наномицели с флуорирано ядро. Angew. Chem. Int. Изд. 55, 755–759 (2016).

Zhang, Z. et al. Ефектът на флуориране на флуороамфифилите при доставка на цитозолен протеин. Нац. комун. 9, 1377 (2018).

Дейвис, М. Е. Първата насочена доставка на siRNA при хора чрез наночастици: от концепция до клиника. Mol. Pharm. 6, 659–668 (2009).

Maity, S., Choudhary, P., Manjunath, M., Kulkarni, A. & amp Murthy, N. Биоразградим адамантанов полимер с кетални връзки в гръбнака за генна терапия. Chem. комун. 51, 15956–15959 (2015).

Chen, X., Qiu, Y. K., Owh, C., Loh, X. J. & amp Wu, Y. L. Супрамолекулярни циклодекстринови наноносители за химио- и генна терапия за ефективно лечение на резистентни към лекарства ракови заболявания. Наномащаб 8, 18876–18881 (2016).

Eldredge, A. C., Johnson, M. E., Oldenhuis, N. J. & amp Guan, Z. Фокусиран библиотечен подход за откриване на дискретни дипептидни болаамфифили за доставка на siRNA. Биомакромолекули 17, 3138–3144 (2016).

Yan, Y. et al. Функционалните полиестери позволяват селективно доставяне на siRNA до рак на белия дроб над съвпадащи нормални клетки. Proc. Натл акад. Sci. САЩ 113, E5702–E5710 (2016).

Hao, J. et al. Бърз синтез на липокатионна полиестерна библиотека чрез полимеризация с отваряне на пръстена на функционални валеролактони за ефективно доставяне на siRNA. J. Am. Chem. Soc. 137, 9206–9209 (2015).

Priegue, J.M. et al. In situ функционализирани полимери за доставка на siRNA. Angew. Chem. Int. Изд. 55, 7492–7495 (2016).

Priegue, J.M. et al. Полимери, активирани с хидразон с различна дължина за кондензация на плазмидна ДНК и клетъчна трансфекция. Биомакромолекули 19, 2638–2649 (2018).

Zhao, Y. et al. Полиметформин комбинира носител и противоракова активност за in vivo доставяне на siRNA. Нац. комун. 7, 11822 (2016).

Lyu, Y. et al. Дендронизиран полупроводников полимер като фототермичен наноносител за дистанционно активиране на генната експресия. Angew. Chem. Int. Изд. 56, 9155–9159 (2017).

Tan, Z., Dhande, Y.K. & Reineke, T.M. Клетъчно-проникващи полимери, съдържащи гуанидиний, предизвикват апоптоза в човешки хепатоцелуларен карцином клетки, освен ако не са конюгирани с насочен към N-ацетил-галактозамин блок. Биоконюг. Chem. 28, 2985–2997 (2017).

Liu, Y., Wenning, L., Lynch, M. & Reineke, T.M. Новите поли(D-глюкарамидоамин) индуцират образуването на ДНК наночастици и ефективно доставяне на ген в клетките на бозайници. J. Am. Chem. Soc. 126, 7422–7423 (2004).

Dong, Y. et al. Поли(гликоамидоамин) четки формулират наноматериали за системно доставяне на siRNA и mRNA in vivo. Нано Лет. 16, 842–848 (2016).

Kaczmarek, J.C. et al. Полимерно-липидни наночастици за системно доставяне на иРНК до белите дробове. Angew. Chem. Int. Изд. 55, 13808–13812 (2016).

Li, J. et al. Структурно програмиран монтаж на наноплекс за иницииране на транслация за превъзходно доставяне на иРНК. ACS Nano 11, 2531–2544 (2017).

Hong, C.A. et al. Дендримерна siRNA за ефективно генно заглушаване. Angew. Chem. Int. Изд. 54, 6740–6744 (2015).

Smith, T.T. et al. Програмиране in situ на специфични за левкемия Т-клетки, използващи синтетични ДНК наноносители. Нац. Нанотехнология. 12, 813–820 (2017). Това проучване описва метод за in situ модификация на Т клетки за имунотерапия на рак.

Graham, F. L. & amp van der Eb, A. J. Нова техника за анализ на инфекциозността на ДНК на човешки аденовирус 5. вирусология 52, 456–467 (1973).

Hong, G., Diao, S., Antaris, A. L. & Dai, H. Въглеродни наноматериали за биологични изображения и наномедицинска терапия. Chem. Rev. 115, 10816–10906 (2015).

Pantarotto, D. et al. Функционализирани въглеродни нанотръби за доставка на ген на плазмидна ДНК. Angew. Chem. Int. Изд. 43, 5242–5246 (2004).

Battigelli, A. et al. Амониеви и гуанидиниеви дендрон-въглеродни нанотръби чрез амидиране и химия на клик и тяхното използване за доставка на siRNA. Малък 9, 3610–3619 (2013).

Kam, NW, Liu, Z. & Dai, H. Функционализация на въглеродните нанотръби чрез разцепващи се дисулфидни връзки за ефективно вътреклетъчно доставяне на siRNA и мощно заглушаване на гена. J. Am. Chem. Soc. 127, 12492–12493 (2005).

Wang, J.T. et al. Връзката между диаметъра на химически функционализираните многостенни въглеродни нанотръби и техните профили на биоразпределение на органи in vivo. Биоматериали 35, 9517–9528 (2014).

Cifuentes-Rius, A. et al. In vivo съдба на въглеродни нанотръби с различни физикохимични свойства за приложения за доставяне на гени. ACS Appl. Матер. Интерфейси 9, 11461–11471 (2017).

Munk, M. et al. Ефективно доставяне на ДНК в говежди предимплантационни ембриони чрез многостенни въглеродни нанотръби. Sci. представител 6, 33588 (2016).

Maeda-Mamiya, R. et al. In vivo доставяне на ген чрез катионен тетраамино фулерен. Proc. Натл акад. Sci. САЩ 107, 5339–5344 (2010).

Sigwalt, D. et al. Генна доставка с поликатионни фулеренови хексакис-адукти. Chem. комун. 47, 4640–4642 (2011).

Wang, J. et al. Видимо светлинно превключвано цитозолно освобождаване на siRNA от амфифилно производно на фулерен за подобряване на ефикасността на RNAi in vitro и in vivo. Acta Biomater. 59, 158–169 (2017).

Dowaidar, M., Abdelhamid, H. N., Hällbrink, M., Zou, X. & Langel, Ü. Нанопластове от графенов оксид в комплекс с проникващи в клетките пептиди за доставка на олигонуклеотиди. Biochim. Биофиз. Acta 1861, 2334–2341 (2017).

Chu, Z. et al. Бързо ендозомно бягство на бодливи нанодиаманти: последици за доставката на ген. Sci. представител 5, 11661 (2015).

Lim, D.G. et al. Нанодиаманти, декорирани с полиамидоамин, като вектор за доставяне на хибриден ген и структурна характеристика на siRNA в заредените интерфейси. ACS Appl. Матер. Интерфейси 9, 31543–31556 (2017).

Zhang, X. Q. et al. Полимерно функционализирани нанодиамантни платформи като превозни средства за доставка на гени. ACS Nano 3, 2609–2616 (2009).

Chen, M. et al. Нанодиамантни вектори, функционализирани с полиетиленімин за доставка на siRNA. J. Phys. Chem. Lett. 1, 3167–3171 (2010).

Yi, Y. et al. Насочена системна доставка на siRNA към модел на рак на маточната шийка, използвайки циклични RGD-инсталирани unimer полийонни комплексно сглобени златни наночастици. J. Контрол. Освободете 244, 247–256 (2016).

Conde, J., Oliva, N., Zhang, Y. & Artzi, N. Локалната тройна комбинирана терапия води до регресия на тумора и предотвратява повторната поява при модел на рак на дебелото черво. Нац. Матер. 15, 1128–1138 (2016).

Lei, Y. et al. Доставяне на NGF siRNA, подпомагано от златни нанокластери, за ефективно лечение на рак на панкреаса. Нац. комун. 8, 15130 (2017).

Cutler, J.I., Auyeung, E. & Mirkin, C.A. Сферични нуклеинови киселини. J. Am. Chem. Soc. 134, 1376–1391 (2012).

Randeria, P.S. et al. Сферичните нуклеинови киселини, базирани на siRNA, обръщат нарушеното заздравяване на рани при диабетни мишки чрез нокдаун на ганглиозид GM3 синтаза. Proc. Натл акад. Sci. САЩ 112, 5573–5578 (2015).

Sita, T.L. et al. Мониторинг на двойна биолуминесценция и близка инфрачервена флуоресценция за оценка на активността на наноконюгата на сферична нуклеинова киселина in vivo. Proc. Натл акад. Sci. САЩ 114, 4129–4134 (2017).

Li, N. et al. Ядрено насочена доставка на siRNA за дългосрочно генно заглушаване. Chem. Sci. 8, 2816–2822 (2017). Тази статия показва ефекта, който субклетъчното разпределение на товара има върху продължителността на заглушаването на гена.

Rouge, J.L. et al. Рибозим – сферични нуклеинови киселини. J. Am. Chem. Soc. 137, 10528–10531 (2015).

Ruan, W. et al. DNA nanoclew шаблонирани сферични нуклеинови киселини за доставяне на siRNA. Chem. комун. 54, 3609–3612 (2018).

Calabrese, C.M. et al. Биосъвместими конюгати на полимер с безкрайна координация на наночастици-нуклеинова киселина за регулиране на антисенс ген. Angew. Chem. Int. Изд. 54, 476–480 (2015).

Banga, R. J., Chernyak, N., Narayan, S. P., Nguyen, S. T. & Mirkin, C. A. Липозомни сферични нуклеинови киселини. J. Am. Chem. Soc. 136, 9866–9869 (2014).

Li, H. et al. Молекулни сферични нуклеинови киселини. Proc. Натл акад. Sci. САЩ 115, 4340–4344 (2018).

Möller, K. et al. Високоефективна доставка на siRNA от мезопорести силициеви наночастици сърцевина-черупка с многофункционални полимерни капачки. Наномащаб 8, 4007–4019 (2016).

Shen, J. et al. Нанопорест силициев носител с висок капацитет за системно доставяне на терапевтични средства за заглушаване на гени. ACS Nano 7, 9867–9880 (2013).

Kapilov-Buchman, Y., Lellouche, E., Michaeli, S. & Lellouche, J. P. Уникална модификация на повърхността на силициевите наночастици с полиетиленимин (PEI) за доставяне на siRNA, използвайки координационна химия на катион на цериев. Биоконюг. Chem. 26, 880–889 (2015).

Shen, J. et al. Многоетапно капсулиране на химиотерапия и генно заглушаващи агенти във функционализирани мезопорести силициеви наночастици. Наномащаб 9, 5329–5341 (2017).

He, C., Lu, K., Liu, D. & Lin, W. Наноразмерни метално-органични рамки за съвместно доставяне на цисплатин и обединени siRNAs за повишаване на терапевтичната ефикасност при резистентни към лекарства ракови клетки на яйчниците. J. Am. Chem. Soc. 136, 5181–5184 (2014).

Chen, Q. et al. Se/Ru-декорирани порести метално-органични рамкови наночастици за доставяне на обединени siRNAs за обръщане на резистентност към множество лекарства в резистентни на таксол клетки на рак на гърдата. ACS Appl. Матер. Интерфейси 9, 6712–6724 (2017).

Thierry, A.R. et al. Характеризиране на липозомно-медиирана генна доставка: експресия, стабилност и фармакокинетика на плазмидна ДНК. Джийн Тер. 4, 226–237 (1997).

Tsui, N. B., Ng, E. K. & amp Lo, Y. M. Стабилност на ендогенна и добавена РНК в кръвни проби, серум и плазма. Clin. Chem. 48, 1647–1653 (2002).

Sahin, U., Karikó, K. & amp Türeci, Ö. Терапевтични средства, базирани на иРНК - разработване на нов клас лекарства. Нац. Rev. Drug Discov. 13, 759–780 (2014).

Layzer, J.M. et al. In vivo активност на устойчиви на нуклеаза siRNAs. РНК 10, 766–771 (2004).


Производство на адено-асоциирани вирусни вектори в клетъчни стекове за предклинични изследвания в големи животински модели

Векторите на адено-асоциираните вируси (AAV) са сред най-напредналите клинично вектори за генна терапия, с три AAV генни терапии, одобрени за хора. Клиничното развитие на новите приложения за AAV включва преход от модели на малки животни, като мишки, към по-големи животински модели, включително кучета, овце и нечовешки примати. Едно от ограниченията при прилагането на AAV на по-големи животни е изискването за големи количества вирус с висок титър. Докато суспензионната клетъчна култура е мащабируем метод за производство на AAV вектор, малко изследователски лаборатории разполагат с оборудването (например биореактори) или знаят как да произвеждат AAV по този начин. Освен това, AAV титрите често са значително по-ниски, когато се произвеждат в суспензионни HEK 293 клетки в сравнение с прилепнали HEK293 клетки. Тук е описан метод за производство на големи количества AAV с висок титър с помощта на клетъчни стекове. Описани са също подробен протокол за титриране на AAV, както и методи за валидиране на чистотата на вектора. Накрая са представени представителни резултати от AAV-медиирана трансгенна експресия в модел на овца. Този оптимизиран протокол за широкомащабно производство на AAV вектори в прилепнали клетки ще даде възможност на лабораториите по молекулярна биология да напреднат в тестването на своите нови AAV терапии в по-големи животински модели.

Въведение

Генната терапия, използваща вектори на адено-асоциирани вируси (AAV), постигна огромен напредък през последните три десетилетия 1, 2 . Демонстрираните подобрения в различни генетични заболявания, включително вродена слепота, хемофилия и заболявания на опорно-двигателния апарат и централната нервна система, изведоха AAV генната терапия на преден план в клиничните изследвания 3, 4 . През 2012 г. Европейската агенция по лекарствата (EMA) одобри Glybera, вектор AAV1, експресиращ липопротеин липаза (LPL) за лечение на дефицит на LPL, което го прави първото разрешение за употреба за лечение с генна терапия в Европа или Съединените щати 5 . Оттогава две допълнителни AAV генни терапии, Luxturna 6 и Zolgensma 7, получиха одобрение от FDA и се очаква пазарът да се разшири бързо през следващите 5 години с до 10-20 генни терапии, очаквани до 2025 г. 8 . Наличните клинични данни показват, че AAV генната терапия е безопасна, добре поносима и ефикасна модалност, което я прави един от най-обещаващите вирусни вектори, с над 244 клинични проучвания, включващи AAV, регистрирани в ClinicalTrials.gov. Нарастващият интерес към клиничните приложения, включващи AAV вектори, изисква стабилни и мащабируеми производствени методи за улесняване на оценката на AAV терапиите в големи животински модели, тъй като това е критична стъпка в транслационния тръбопровод 9 .

За производството на AAV вектор, двете основни изисквания са AAV геномът и капсидът. Геномът на див тип (wt)-AAV е едноверижна ДНК, която е приблизително 4,7 kb на дължина 10 . Геномът wt-AAV включва инвертирани терминални повторения (ITR), открити в двата края на генома, които са важни за опаковането, и представител и шапка с козирка гени 11 . В представител и шапка с козирка гените, необходими за репликация на генома, сглобяване на вирусния капсид и капсулиране на генома във вирусния капсид, се отстраняват от вирусния геном и се предоставят в транс за производство на AAV вектор 12 . Отстраняването на тези гени от вирусния геном осигурява място за терапевтични трансгени и всички необходими регулаторни елементи, включително промотора и полиА сигнала. ITR остават във векторния геном, за да осигурят правилна репликация на генома и вирусно капсулиране 13, 14. За да се подобри кинетиката на трансгенна експресия, AAV векторните геноми могат да бъдат конструирани така, че да бъдат самодопълващи се, което смекчава необходимостта от преобразуване от едноверижна в двуверижна ДНК конверсия по време на репликация на AAV генома, но намалява капацитета на кодиране до

Отвъд дизайна на AAV генома, селекцията на капсид серотип определя тъканния и клетъчния тропизъм на AAV вектора in vivo 2 . В допълнение към тъканния тропизъм е показано, че различните AAV серотипове показват различна кинетика на генна експресия 16 . Например, Zincarelli et al. 17   класифицира различни AAV серотипове в серотипове с ниска експресия (AAV2, 3, 4, 5), серотипове с умерена експресия (AAV1, 6, 8) и серотипове с висока експресия (AAV7 и 9). Те също така категоризираха серотиповете на AAV в експресия с бавно начало (AAV2, 3, 4, 5) или експресия с бързо начало (AAV1, 6, 7, 8 и 9).Тези различни тропизми и кинетика на генната експресия се дължат на аминокиселинни вариации в капсидните протеини, образувания на капсидни протеини и взаимодействия с рецептори/корецептори на клетката гостоприемник 18 . Някои AAV капсиди имат допълнителни полезни характеристики, като например способността да преминават кръвно-мозъчната бариера след интраваскуларно приложение (AAV9) или да пребивават в дългоживеещи мускулни клетки за трайна трансгенна експресия (AAV6, 6.2FF, 8 и 9) 19, 20 .

Тази статия има за цел да детайлизира рентабилен метод за производство на AAV вектори с висока чистота и висок титър за използване в предклинични модели на големи животни. Производството на AAV с помощта на този протокол се постига с помощта на трансфекция с двоен плазмид в прилепнали човешки ембрионален бъбрек (HEK)293 клетки, отглеждани в клетъчни стекове. Освен това, проучването описва протокол за пречистване с хепарин сулфатна афинитетна хроматография, който може да се използва за AAV серотипове, които съдържат хепарин-свързващи домени, включително AAV2, 3, 6, 6.2FF, 13 и DJ 21, 22.

Налични са редица опаковъчни системи за производството на AAV вектори. Сред тях е използването на двуплазмидни системи за котрансфекция, при които представител и Шапка с козирка гени и Ad помощни гени (E1A, E1B55K, E2A, E4orf6 и VA RNA) се съдържат в един плазмид (pHelper), има някои практически предимства пред обикновения триплазмиден (троен) метод на трансфекция, включително намалени разходи за производство на плазмид 23 , 24 . AAV геномният плазмид, съдържащ трансгенната експресионна касета (pTransgene), трябва да бъде ограден от ITR и не трябва да надвишава

4,7 kb дължина. Титърът и чистотата на вектора могат да бъдат повлияни от трансгена поради потенциални цитотоксични ефекти по време на трансфекцията. Оценката на чистотата на вектора е описана тук. Вектори, произведени с помощта на този метод, които дават 1 х 10 13 vg/mL за всеки, бяха оценени при мишки, хамстери и модели на овце.

Таблица 1: Състав на необходимите разтвори. Необходима информация, включително проценти и обеми, на компонентите, необходими за различни решения в целия протокол. Моля, щракнете тук, за да изтеглите тази таблица.

Изисква се абонамент. Моля, препоръчайте JoVE на вашия библиотекар.

Протокол

1. Двойна плазмидна трансфекция на HEK293 клетки в клетъчни стекове

  1. Размразете крио-флакон с клетки HEK293 в вана с перли, настроена на 37 °C.
    ЗАБЕЛЕЖКА: Предварително загрейте целия DMEM до 37 °C, докато клетките се размразяват, за да се гарантира, че студената температура няма да удари клетките при нанасяне на покритие. Уверете се, че клетките имат нисък брой пасажи, в идеалния случай по-малко от 20, за да осигурите оптимален растеж и ефективност на трансфекция. Уверете се, че клетките са сертифицирани като свободни от микоплазма.
  2. Прехвърлете съдържанието на крио-флакона на капки в 15 mL конична епруветка, съдържаща 10 mL предварително затоплен пълен DMEM и центрофугирайте клетките при 500 x ж за 5 мин.
  3. Аспирирайте средата и след това ресуспендирайте клетките HEK293 в 20 mL предварително затоплен пълен DMEM. Посейте клетките в 15 cm плоча и инкубирайте при 37 °C, с 5% CO2.
  4. Разделете клетките от една 15 см плака на три за посяване в камерата за клетъчна култура.
    1. След като клетките са 80% сливащи се, аспирирайте средата и внимателно измийте плочата с 3 mL PBS, за да не разрушите монослоя. След това аспирирайте PBS и добавете 3 mL трипсин.
    2. Инкубирайте в продължение на 2 минути при 37 °C, докато клетките се повдигнат от плаката, и след това неутрализирайте трипсина чрез добавяне на 7 mL пълен DMEM към плаката.
    3. Съберете цялата среда и клетки в епруветка от 15 mL и клетките се пелетират чрез центрофугиране при 500 x ж за 5 мин.
    4. Аспирирайте супернатантата от 15 mL епруветка и ресуспендирайте клетъчната пелета в 3 mL пълен DMEM. Добавете 1 mL към всяка 15 cm плака, съдържаща 20 mL пълен DMEM, внимателно разклатете чиниите, за да разпределите клетките равномерно, и инкубирайте при 37 °C, с 5% CO2.

    65-h инкубация, проверете референтната плоча за сливане - идеално


    Фигура 1: Маневриране на клетъчен стек за клетъчно засяване и трансфекция. За засаждане на клетъчен пакет, започнете с премахване на една от вентилационните капачки и изсипване в 1 L предварително затоплен пълен DMEM с необходимото количество HEK293 клетки (А). Равномерно разпределете клетките и медиите, като затегнете двете вентилационни капачки и донесете всички носители в ъгъла на стека клетки с една от вентилационните капачки и я поставете в този ъгъл (Б), поставете стека от клетки отстрани (° С), и след това завъртете стека от клетки 90° (д), така че вентилационните отвори да са нагоре (Е). Внимателно спуснете пакета клетки до нормалното му хоризонтално положение и се уверете, че всички камери на пакета клетки са напълно покрити с носител (Ф). Когато трансфектирате, развийте и двете вентилационни капачки и бавно изсипете старата среда в контейнер за стерилни отпадъци за равномерен поток, който да не нарушава монослоя на клетките (Г). Моля, щракнете тук, за да видите по-голяма версия на тази фигура.

    1. Пригответе смес от полиетиленимин (PEI)/ДНК при съотношение на концентрация 3:1 (w/w).
      1. Пригответе ДНК сместа в 50 mL конична епруветка, като добавите 475 µg pTrangene и 1425 µg pHelper към 40 mL среда с намален серум, за да създадете съотношение 3:1 pHelper:pTrangene.
        ЗАБЕЛЕЖКА: Калкулаторът на сместа PEI/DNA може да бъде намерен като използвате Таблица 2.
      2. Добавете 5,7 mL PEI (1 g/L) към средата с намален серум и ДНК сместа на капки. След това разбъркайте за кратко и инкубирайте за 10 минути при стайна температура.
        ЗАБЕЛЕЖКА: Тъй като PEI/DNA се инкубира при стайна температура, тя ще стане леко мътна.

      2 Събиране на AAV и химичен лизис на трансфектираните HEK293 клетки

      1. Разклатете енергично камерата за клетъчна култура, за да изместите клетките, докато средата изглежда мътна от изместените клетки и се изсипва в четири 500 mL центрофужни епруветки.
      2. Центрофугирайте епруветките при 18 000 x ж за 30 минути при 4 °°С, за да се пелетират клетките. Изсипете избистрения супернатант в бутилка от 1 L полиетилен терефталат кополиестер (PETG).
        ЗАБЕЛЕЖКА: Ако човек няма достъп до високоскоростна центрофуга, центрофугирайте при 12 000 x ж за 40 мин. Пелетираните клетки може да не са твърди при тази скорост и ще се плъзгат като изливане на супернатант.
      3. Ресуспендирайте клетъчните пелети в 500 mL центрофужни епруветки с 50 mL лизисен буфер и инкубирайте за 60 минути при 37 °C.
      4. Центрофугирайте епруветките при 18 000 x ж за 30 минути и след това прехвърлете супернатантата в същата 1 L PETG бутилка. Изхвърлете гранулираните клетъчни остатъци.
        ​ЗАБЕЛЕЖКА: Пречистете незабавно избистрения супернатант и го съхранявайте при 4 °C за до 72 часа. За по-дългосрочно съхранение съхранявайте при -80 °C. Не съхранявайте при -20 °C.

      3 AAV Векторно пречистване с помощта на хепарин афинитетна хроматография

      1. Отстранете суровия лизат от -80 °C и оставете при 4°C за една нощ, за да се размрази. След размразяване използвайте 0,22 µM филтър за филтриране на суровия лизат.
      2. За да пасивирате центробежния концентратор, добавете 4 mL буфер за предварителна обработка на филтъра към центробежен концентратор за всяка използвана колона за хепарин сефароза. Пасивирайте центробежния концентратор при стайна температура за 2-8 часа. Настройте пасивирането непосредствено преди стъпките за пречистване.
      3. Настройте тръбата и помпата (Фигура 2).
        1. Поставете тръбичката в перисталтична помпа и пуснете 20 mL 1 М NaOH. След това пуснете 50 mL вода с молекулно качество и след това пуснете 50 mL базален DMEM.
        2. Прикрепете колона от 5 mL хепарин сефароза към епруветката и пуснете 25 mL базален DMEM, за да премахнете консерванта.


        Фигура 2: Настройка за перисталтична помпа за пречистване на AAV. Прокарайте епруветката от суровия лизат, през перисталтичната помпа и в колоната с хепарин матрица. Моля, щракнете тук, за да видите по-голяма версия на тази фигура.

        ЗАБЕЛЕЖКА: Уверете се, че не създавате мехурчета или оставяте колоната да изсъхне, тъй като това ще компрометира колоната и ще предотврати елуирането на AAV. Изхвърлете колоната, ако изсъхне и използвайте нова колона за остатъка от суровия лизат.

        1. Заредете целия суров лизат върху хепариновата колона и използвайте следните разтвори, за да измиете колоната.
          1. Измийте с 50 mL 1x балансирани солеви разтвори на Hank's (HBSS) без Mg 2+ и Ca 2+.
          2. Измийте с 15 mL 0,5 % N-лауроилсаркозин в HBSS без Mg 2+ и Ca 2+.
          3. Измийте с 50 mL HBSS без Mg 2+ и Ca 2+.
          4. Измийте с 50 mL HBSS с Mg 2+ и Ca 2+
          5. Измийте с 50 mL 200 mM NaCl/HBSS с Mg2+ и Ca 2+.
          6. Елуирайте 5 x 5 mL (25 mL общо) с 300 mM NaCl/HBSS с Mg 2+ и Ca 2+ и маркирайте елуирането като E1-E5 (всяко елуиране е от 5 mL).

          4 AAV геномна ДНК екстракция

          1. Пригответе реакционната смес, посочена в Таблица 3 в PCR епруветка за лечение с ДНКаза.

          Таблица 3: Формула на главната смес за третиране с ДНКаза. Препоръчителни компоненти и обеми, необходими за третиране с ДНКаза на AAV вирусни вектори по време на екстракция на ДНК.

          1. Вортексирайте PCR епруветката за смесване и пулсирайте PCR епруветката, за да завъртите съдържанието.
          2. Използвайки термоциклер, инкубирайте при 37 °C за 20 минути, последвано от 75°C за 15 минути, за да инактивирате ДНКазата на топлина.
          3. Добавете 5 µL протеиназа К.
          4. Използвайки термоциклер, инкубирайте при 50 °C за 60 минути и след това при 95°C за 30 минути, за да инактивирате протеиназа К.
          5. Използвайте комплект за почистване на ДНК, за да премахнете потенциалните замърсители.
            ЗАБЕЛЕЖКА: Тази стъпка е извършена с помощта на наличен в търговската мрежа комплект за почистване на кръв и тъкани (Таблица на материалите).
            1. Добавете 200 µL AL буфер (комплект за почистване на кръв и тъкани, Таблица на материалите) към PCR епруветката, съдържаща третирания с ДНКаза/протеиназа К вектор.
            2. Вортексирайте PCR епруветката и инкубирайте при 56 °C за 10 минути в термоциклер.
            3. Пипетирайте течността от PCR епруветката в стерилна центрофуга, разположена в събирателна епруветка.
            4. Добавете 200 µL 100% етанол към колоната и разбъркайте старателно чрез завихряне.
            5. Центрофугирайте при 6000 x ж за 1 минута и изхвърлете потока.
            6. Добавете 500 µL буфер AW1 (комплект за почистване на кръв и тъкани, Таблица на материалите) към въртящата се колона.
            7. Центрофугирайте при 6000 x ж за 1 минута и изхвърлете потока.
            8. Добавете 500 µL буфер AW2 (комплект за почистване на кръв и тъкани, Таблица на материалите) към въртящата се колона.
            9. Центрофугирайте при 15 000 x ж за 3 минути и изхвърлете потока.
            10. Поставете центрофужната епруветка от 1,5 mL и добавете 200 µL буфер AE (комплект за почистване на кръв и тъкани, Таблица на материалите) директно към мембраната на спин колона.
            11. Инкубира се при стайна температура за 1 минута.
            12. Центрофугирайте при 6000 x жза 1 минута за елуиране на ДНК.
            13. Съхранявайте ДНК при -20 °C.

            5 Титруване на AAV векторни геноми с помощта на количествена полимеразна верижна реакция и сонда за Simian Virus 40 (SV40)

            ЗАБЕЛЕЖКА: Извършвайте цялата qPCR работа в PCR качулка, като използвате филтрирани накрайници за пипети, за да избегнете външно замърсяване с ДНК. Ако AAV геномът не кодира SV40 polyA последователност, използвайте сонда срещу ITR, описан другаде 25 . Уверете се, че плазмидната ДНК, избрана като стандарт, съдържа SV40 polyA последователност.

            1. Стандартна подготовка на запасите
              1. Разредете основния плазмиден ДНК стандарт (pTransgene плазмид, съдържащ SV40 polyA последователност) до крайна концентрация от 10 µg/µL и съхранявайте при -20 °C в 6 µL аликвоти.
              2. Определете броя на копията в стандарта на плазмидна ДНК, като използвате следния онлайн калкулатор 26 .
                ЗАБЕЛЕЖКА: Използвайте плазмидна ДНК, използвана за стандарта, произведен от търговски доставчик, за да осигурите качество и правилна концентрация. Пригответе голямо количество стандарт (например 10 mL) за провеждане на свързващи изследвания при преминаване към новоприготвен стандарт.

              Таблица 4: qPCR основна смес за AAV титруване. Препоръчителни компоненти и обеми, необходими за qPCR на ДНК, извлечена от AAV вирусни вектори.

              Съставна част Последователност
              Напред грунд 5’-AGCAATAGCATCACAAATTTCACAA-3’
              Обратен грунд 5’-CCAGACATGATAAGATACATTGATGAGTT-3’
              Сонда /56-FAM/AGCATTTTT/Zen/TTCACTGCATTCTAGTTGTGGTTTGTC/3IABkFQ

              Таблица 5: Праймерни последователности срещу SV40 polyA ДНК последователност. Последователности на праймерите и сондата, използвани за qPCR титруване, които се свързват със специфични области на AAV вирусни вектори, които съдържат SV40 polyA последователността.

              1. Пипетирайте основната смес нагоре и надолу, за да смесите.
              2. Поставете плочата за разреждане.
                1. Използвайте прозрачна 96-ямкова плака, за да приготвите стандартни и пробни разреждания, добавете 45 µL вода с молекулно качество към всяка ямка във всяка друга колона, започвайки с колона 1 (колони 1, 3, 5, 7, 9 и 11).
                2. Добавете 5 µL от стандарта към ямка A1 и пипетирайте за смесване.
                3. Използвайте нов филтриран накрайник за пипета, за да създадете разреждане 1/10 от ямка A1 до B1.
                4. Продължете серия от 10-кратни разреждания надолу по колоната, докато достигнете G1.
                5. Не добавяйте към H1, тъй като това ще действа като отрицателна контрола.
                6. Приложете първата проба (S1), като я добавите към ямка A3, като образувате разреждане 1/10. Пипетирайте тази смес и прехвърлете 5 µL в ямка B3. Изхвърлете върха на пипетата след това прехвърляне.
                7. С нов накрайник за пипета смесете разтвора в ямка B3 и оформете разреждане 1/100. Прехвърлете 5 µL от тази смес в ямка C3 и изхвърлете върха след прехвърлянето.
                8. С нов накрайник за пипета, пипетирайте нагоре и надолу разтвора в кладенче С3, за да направите разреждане 1/1000. Изхвърлете върха.
                9. Продължете да разреждате пробите, без да добавяте проби към колони 2, 4, 6, 8, 10 или 12.
                10. След като всички проби се разредят, смесете съдържанието в ямките на колона 1 и след това прехвърлете 20 µL в колона 2.
                11. Повторете това за колони 3, 5, 7, 9 и 11, за да създадете повторения на всеки стандарт и разреждане на пробата. Препоръчай на Фигура 3 за оформление на плочата.
                  ​ЗАБЕЛЕЖКА: Когато следите настройката на плочата в Фигура 3, пробите, разредени в редове G и H, ще имат само разреждания 1/10 и 1/100.


                Фигура 3: Оформление на плочата за qPCR AAV титруване. Синьото показва поставянето на серийното разреждане на стандарта зелено показва поставянето на отрицателната контрола, лилаво показва поставянето на разреждането на пробите. Всеки стандарт, негатив или проба се добавя в повторение. Добавен е пример за концентрацията на стандарта, за да се покаже серията от разреждане на стандарта, и поставянето на разреждания на пробата е добавено към съответните им ямки. Моля, щракнете тук, за да видите по-голяма версия на тази фигура.

                1. Титруване чрез qPCR на базата на откриване на SV40 polyA
                  1. Добавете 15 µL qPCR главен микс към всяка ямка на 96-ямкова qPCR плака с бяла полуперва.
                  2. Прехвърлете 5 µL от всяка проба от прозрачната 96-ямкова плака в 96-ямковата qPCR плака с бяла полуобвивка.
                  3. Използвайте многоканална пипета, за да осигурите адекватно смесване на qPCR основната смес и пробата.
                  4. Запечатайте плаката със запечатващ филм и центрофугирайте qPCR плочата при 1500 x ж за 30 с.
                  5. Изпълнете qPCR реакцията на базиран на плака PCR инструмент за амплификация и откриване в реално време, като използвате предложените условия в Таблица 6.

                  Таблица 6: Протокол на Thermocycler за qPCR титруване на базата на хидролизна сонда. Препоръчителен протокол за термоциклиране за използване на базирано на сонда qPCR титруване на извлечени от ДНК пречистени AAV вектори.

                  ЗАБЕЛЕЖКА: За qPCR AAV работен лист за титруване вж Таблица 7.

                  1. Анализ на данни за определяне на броя на копията на AAV генома.
                    1. Попълнете клетките с данни в електронната таблица (Таблица 7А) със стойностите на концентрацията, получени от qPCR теста както за стандартно, така и за разреждане на пробата.
                    2. Използвайте стойности за концентрация от Таблица 7А да се създаде стандартна крива (Таблица 7В).
                      ЗАБЕЛЕЖКА: Стандартната крива ще бъде показана като естествен логаритъм (г = а ln(х) + б) заедно с ефективността на R 2. Стандартната крива трябва да има ефективност близо до 100 % и R 2 близо до 1.0 (𕟲.99).
                    3. Попълнете ефективността на наклона, като попълните този онлайн калкулатор 27 .
                      ЗАБЕЛЕЖКА: Ефективност между 90%-110% е приемлива. Ако ефективността на qPCR е извън този диапазон, повторете qPCR.
                    4. Използвайте стойности за концентрация от Таблица 7А за осредняване на разрежданията на всяка проба и определяне на стандартното отклонение на всяка проба (Таблица 7C).
                      ЗАБЕЛЕЖКА: Изключете разрежданията от проби, които са на повече от едно стандартно отклонение от средната стойност на разрежданията на пробата.
                    5. Използвайки средната концентрация на всяко разреждане, умножете по коефициента на разреждане и след това разделете на пет, за да получите векторните геноми (vg)/µL на всяка проба (Таблица 7C).
                    6. Изчислете vg/mL на всяка проба, като умножите средната стойност на концентрациите на всяка проба по 80 000 (Таблица 7C).
                    7. Осреднете vg/mL на всяко разреждане, за да получите крайния vg/mL на всяка проба (Таблица 7C).
                      ​ЗАБЕЛЕЖКА: Потребителят трябва да раздели средната концентрация на всяко разреждане на коефициент пет, за да отчете 5 µL, заредени във всяка ямка за qPCR цикъла, за да произведе концентрацията в vg/µL. Коефициентът 80 000 отчита прехода от стойността на средната концентрация на всяка проба към vg/mL. Първо, средната стойност на концентрацията на всяка проба трябва да се умножи по 2, за да се отчетат едноверижните геноми, тъй като наборът праймер-сонда определя количествено само едноверижна ДНК с положителен смисъл (ssDNA) и AAV геномът съществува в приблизително съотношение 1:1 между ssDNA с положителен и отрицателен смисъл 25, 28 . Средната стойност на концентрацията на всяка проба трябва да се умножи x40, за да се отчете разреждането на пробата от 5 µL пречистен вектор (раздел 4.1) до 200 µL екстрахирана ДНК (раздел 4.6.12). И накрая, средната стойност на концентрацията на всяка проба трябва да се умножи x1000, за да се преобразува от vg/µL в vg/mL.

                    6 Оценка на качеството и чистотата на вектора

                    1. Контрол на качеството - Western Blot
                      1. Пригответе 12% SDS PAGE гел.
                      2. Извършете електрофореза с полиакриламиден гел.
                        ЗАБЕЛЕЖКА: Заредете 6 x 10 10 vg проби на ямка.
                      3. Прехвърлете протеините към поливинилиден дифлуорид (PVDF) мембрана.
                      4. Блокираща PVDF мембрана
                        1. Отстранете мембраната от апарата за прехвърляне и изплакнете с 0,1% PBST, за да премахнете свободния акриламид.
                        2. Поставете мембраната в блокиращ разтвор за най-малко 1 час при стайна температура или за една нощ при 4 °C.
                          ЗАБЕЛЕЖКА: Блокиращият буфер може да бъде допълнително допълнен с 2% кози серум.
                        1. Декантирайте блокиращия буфер и добавете първичното антитяло, анти-AAV мише моноклонално антитяло в разреждане 1:200.
                        2. Инкубирайте една нощ при 4 °C.
                        3. Декантирайте първичното антитяло и промийте пет пъти с 0,1% PBST за 5 минути при стайна температура с разбъркване.
                        1. Декантирайте промивния разтвор и добавете HRP конюгирано вторично антитяло, разредено при 1:7500 в блокиращ буфер, и инкубирайте за 1 час при стайна температура с разбъркване.
                        2. Декантирайте вторичното антитяло и промийте пет пъти с 0,1% PBST за 5 минути при стайна температура с разбъркване.
                        3. Извършете окончателно измиване с PBS при стайна температура с разбъркване.


                        Фигура 4: Western blot показва AAV капсидни протеини. Ивица A MW стълба, лента B AAV6.2FF-hIgG01, лента C AAV6.2FF-hIgG02, лента D AAV6.2FF-hIgG03 и лента E AAV6.2FF-hIgG04. 6 x 10 10 vg от всеки AAV6.2FF-hIgG бяха заредени в съответните им ленти. Моля, щракнете тук, за да видите по-голяма версия на тази фигура.

                        1. Контрол на чистотата - SDS PAGE и Coomassie Stain
                          1. Пригответе SDS-PAGE гел и проби, както е описано от стъпки 6.1.1 и 6.1.2.
                          2. Фиксирайте гела във фиксиращ разтвор за 1 час или за една нощ с леко разбъркване. Сменете фиксиращия разтвор веднъж през първия час.
                          3. Оцветете гела в разтвор за оцветяване в продължение на 2-4 часа с леко разбъркване.
                          4. Обезцветете гела с разтвор за обезцветяване. Допълнете разтвора за обезцветяване няколко пъти, докато фонът на гела бъде напълно обезцветен (4-24 часа).
                          5. Съхранявайте обезцветения гел в разтвор за съхранение.
                          6. Изобразете гела, за да визуализирате всички протеини, оцветени с оцветяващ разтвор Coomassie.


                          Фигура 5: Оцветен с Coomassie гел. Лента A MW стълба, лента B AAV6.2FF-hIgG01, лента C AAV6.2FF-hIgG02, лента D AAV6.2FF-hIgG03, лента E AAV6.2FF-hIgG04, лента F AAV6.2FF-hIgG05 и лента. 2FF-hIgG06. 6 x 10 10 vg от всеки AAV6.2FF-hIgG бяха заредени в съответните им ленти. Моля, щракнете тук, за да видите по-голяма версия на тази фигура.

                          1. Алтернативен анализ за контрол на чистотата - HEK293 ELISA за откриване на протеин в клетката гостоприемник
                            1. Извършете откриване на протеин на клетката гостоприемник HEK293 чрез ELISA съгласно инструкциите на производителя.
                              ЗАБЕЛЕЖКА: Използвайте разреждания от 5 x 10 -2 и 1 x 10 -3 за пречистени rAAV проби. След като TMB се добави към ямката, инкубирайте далеч от светлина. Линейната регресия не може да се използва за анализ на резултатите.
                            2. Извършете анализ от точка до точка, кубичен сплайн или четирипараметърен логистичен метод, за да интерполирате концентрациите на неизвестни и умножете по коефициента на разреждане, за да определите първоначалната концентрация на пробата.

                            Изисква се абонамент. Моля, препоръчайте JoVE на вашия библиотекар.

                            Представителни резултати

                            Преводът от модели на малки гризачи към по-големи животински модели и евентуално клинично приложение представлява значително предизвикателство поради голямото количество AAV, необходимо за трансдуциране на по-големи животни и постигане на терапевтични ефекти. За да се сравни ефективността на трансдукция на рационално проектирания капсид AAV6.2FF, по-рано демонстрира 101-кратно увеличение на ефективността на трансдукция в миши мускулни клетки в сравнение с AAV6 3 , на мишки, хамстери и агнета се прилага AAV6.2FF, експресиращ човешко моноклонално антитяло ( hIgG). AAV6.2FF-hIgG-експресиращият вектор съдържа CASI промотор 4, хепатит Woodchuck вирус пост-транскрипционен регулаторен елемент (WPRE) и SV40 polyA последователност. Шестседмични женски BALB/c (n = 4) мишки бяха приложени интрамускулно (IM) 1 x 10 11 vg AAV6.2FF-hIgG в 40 µL и кръвта беше събрана на дни 0, 7, 14, 21 и 28 след прилагане на AAV за мониторинг на hIgG. На четириседмични сирийски хамстери (две женски и двама мъжки) им се прилага IM 1 х 10 12 vg AAV6.2FF-hIgG в 40 µL и кръвта се събира седмично за проследяване на експресията на hIgG. Накрая, на 10-дневни мъжки агнета Dorset (n = 3) им се прилага 1 x10 13 vg/kg AAV6.2FF-hIgG в две до три инжекции от 1 mL в задницата. Седмичното вземане на кръв е завършено с югуларно кървене и hIgG се проследява седмично в продължение на 28 дни. Всички експерименти с животни са одобрени от Институционалния комитет за грижа за животните на Университета в Гвелф.

                            Мишки IM са приложени 5 x 10 12 vg/kg AAV6.2FF-hIgG, експресиран между 171-237 µg/mL hIgG в серума до 28-ия ден след приложението (Фигура 6). Хамстери IM прилагани 2 x 10 13 vg/kg AAV6.2FF-hIgG експресират много по-високи нива от мишките, със серумни нива на hIgG от 495-650 µg/mL до 28-ия ден след приложението. И накрая, овце IM са приложени 1 х 10 13 vg/kg експресирани серумни нива на hIgG от 21-46 µg/mL до ден 28 след приложението. При всички животински модели изглежда, че векторът не възпрепятства никакви здравни показатели, като тегло, доказвайки безопасността и качеството на произведените вектори. Добре известно е, че AAV-медиираната експресия на моноклонално антитяло (mAb) варира значително в зависимост от вида и mAb. Доколкото е известно на авторите, няма съобщения за експресия на AAV-mAb при видове овце, така че няма еталон за очакваните нива на експресия. Трябва да се отбележи, че овцете в това проучване са удвоили теглото си през 28-дневния период след инжектирането и че животните в Фигура 6 всички бяха трансдуцирани с различни AAV-mAbs и следователно не могат да бъдат сравнени.


                            Фигура 6: Интрамускулното доставяне на AAV6.2FF-hIgG води до продължителна серумна експресия на hIgG при мишки, хамстери и овце. Женски BALB/c мишки (n = 4) бяха приложени IM 5 х 10 12 vg/kg AAV6.2FF-hIgG, сирийски хамстери (2 мъжки, 2 женски), бяха приложени IM 1 х 10 13 vg/kg от AAV6. 2FF-hIgG и 10-дневни мъжки агнета Dorset (n = 3) бяха приложени IM 1 х 10 13 vg/kg. Серумът се проследява за експресия на hIgG за период от 28 дни. Данните са представени като средно ± стандартно отклонение. Моля, щракнете тук, за да видите по-голяма версия на тази фигура.

                            Трансфекция на камерата за клетъчна култура
                            протокол
                            1. Оставете ДНК, OptiMEM и PEI да се затоплят до стайна температура преди трансфекцията
                            2. Въведете броя на клетъчните стекове, които ще бъдат трансфектирани (не се изисква излишък)
                            3. Уверете се, че концентрациите на ДНК са правилни, тъй като това ще промени необходимите обеми
                            Брой камери за клетъчни култури 1
                            Концентрация на трансгенен плазмид 1 mg/mL
                            Концентрация на pDGM6.2FF плазмид 1 mg/mL
                            Количество на камери за клетъчна култура Mastermix за трансфекция
                            OptiMEM 48.1 mL 48.1 mL
                            Съотношение 1:3 pTransgene:pHelper pТрансген 475 µg 475 µL
                            pHelper 1425 µg 1425 µL
                            4. Добавете необходимите обеми OptiMEM и плазмидна ДНК към 50 mL конична епруветка
                            5. Обърнете 10 пъти, за да разбъркате
                            3:1 PEI:DNA съотношение PEI Макс 5.7 mL 5.7 mL
                            6. Добавете необходимото количество PEI към 50 mL епруветка, съдържаща OptiMEM и плазмидна ДНК
                            7. Незабавно затворете епруветката от 50 mL и разбъркайте на вихър и обърнете 3𔃃 пъти, за да разбъркате.
                            8. Задайте таймер за 10 минути, за да се инкубират PEI комплексите
                            9. Преместете клетъчните стекове, които да бъдат трансфектирани в BSC
                            10. След 10 минути изсипете сместа за трансфекция в един оранжев порт.
                            11. Внимателно разбъркайте течността в цялата клетка
                            12.  Върнете стека от трансфектираните клетки в инкубатора, като осигурите равен обем на всеки слой
                            13. Събиране на камера за клетъчни култури 72 часа по-късно

                            Таблица 2: Трансфекция калкулатор за камера за клетъчни култури. Интерактивен работен лист за определяне на правилната концентрация на pTransgene, pHelper и PEI за трансфекция на камерата за клетъчна култура.

                            Таблица 7: Калкулатор за титруване на AAV. Интерактивен работен лист за определяне на крайната концентрация на AAV проби от qPCR, изразена като vg/mL. Моля, щракнете тук, за да изтеглите тази таблица.

                            Изисква се абонамент. Моля, препоръчайте JoVE на вашия библиотекар.

                            Дискусия

                            Производството на рекомбинантни AAV (rAAV) вектори, описани в тази статия, използва общи материали, реагенти и оборудване, открити в повечето от изследователските лаборатории и съоръжения за молекулярна биология. Тази хартия позволява високо качество инвитро и in vivo клас rAAV да бъде произведен от читателя. Преди всичко, този протокол за производство на rAAV, в сравнение с по-досадните протоколи, включващи пречистване на цезиев хлорид, е ефективен и избягва използването на ултрацентрофугиране. След като клетките HEK293 бъдат трансфектирани, пречистеният AAV е готов за употреба в рамките на 5 работни дни.

                            По време на процеса на производство и пречистване на rAAV много стъпки могат да повлияят на чистотата и крайния титър на вектора. Първата и най-критична стъпка е здравето на клетките HEK293, което има пряк ефект върху титъра на вектора. Използването на клетки HEK293, за разлика от други типове или системи клетки, като клетки HEK293T, е изгодно с това, че клетките HEK293 имат по-голяма способност да се придържат към пластмасовото покритие на плочи и клетки, създавайки здрави клетъчни мрежи за непрекъснат клетъчен растеж. Препоръчва се да се наблюдават клетките за замърсяване с микоплазма и да се избягва преминаването на HEK293 клетки покрай тях

                            40 пасажа или след като времето за удвояване изглежда се забавя, тъй като това ще доведе до по-ниски добиви на AAV. Освен това, потвърждаването на клетките са приблизително 80% сливащи се преди трансфекцията, гарантира, че клетките не са твърде редки или обрасли. По отношение на компонентите на трансфекцията силно се препоръчва използването на висококачествена плазмидна ДНК (например, приготвена в търговската мрежа плазмидна ДНК), за да се гарантира, че ДНК остава в разтвор и взаимодейства правилно с компоненти за доставяне на химична трансфекция, като PEI. И накрая, реагентът за трансфекция има значително влияние върху добивите на rAAV. Тук PEI се използва като агент за трансфекция. PEI е стабилен катионен полимер, който доставя екзогенна ДНК в ядрото на клетките чрез производство на плазмид-полимерни комплекси, които след това се поемат от клетките и се транспортират до ядрото чрез процеси на клетка-гостоприемник 29 . Трансфекциите на базата на PEI са бързи и лесни в сравнение с други методи за доставка на ДНК, включително калциев фосфат или липофектамин. Съотношението PEI:DNA обаче трябва да бъде оптимизирано.

                            Използването на клетъчни стекове, за разлика от традиционните прилепнали плочи, осигурява по-удобен и последователен метод за производство на rAAV. Клетъчните купчини включват по-малко технически манипулации по време на трансфекцията, смекчавайки възможното изместване на клетките от прилепналия монослой, позволявайки по-силни клетъчни мрежи и по-добро производство на rAAV. След трансфекцията събирането на супернатанта и лизирането на клетките е ефективно и последователно. За събиране на rAAV от клетките, физическите методи за клетъчен лизис като замразяване-размразяване са неефективни и непоследователни, тъй като няма начин да се гарантира, че всички клетки са лизирани. Тук е описана процедура за химичен лизис. Използването на буфер за химичен лизис гарантира, че всички клетки са изложени на лизиращия агент в специфична концентрация, както и на добавки като протеазен инхибитор за предотвратяване на разграждането на капсида. Този метод по-последователно лизира клетките, позволявайки по-ефективно събиране на rAAV. Освен това, гранулирането и отстраняването на клетъчните остатъци елиминира възможните замърсители от суровия лизат, което може да увеличи времето и разходите за филтриране на лизата преди пречистването.

                            Въпреки че rAAV може да присъства във високи количества в суровия лизат, актът на улавяне и почистване на rAAV може да се различава при различните методи за пречистване, като градиенти на цезиев хлорид. Тук използването на афинитетно хроматографско пречистване с хепарин сефароза осигурява бърз и лесен метод за пречистване на вектор, което води до свръхчист вирус и не изисква градиентно ултрацентрофугиране. Въпреки това, не всички AAV серотипове съдържат хепарин-свързващи домени, така че за тези серотипове този метод на пречистване не би бил подходящ. Например, докато AAV2 и AAV6 свързват хепарин сулфат, AAV4 и AAV5 не 30 . Въпреки че този метод не е универсален, той е ефективен и лесен за онези капсиди, които свързват хепарин сулфат. За разлика от градиенти на ултрацентрофугиране като йодиксанол, всички rAAV частици са свързани с мембраната на колоната, докато се елуират с помощта на промивки с висока концентрация на соли, като се избягват проблеми като смесване на градиенти и умения, необходими за възстановяване на фракции от градиента. Елуирането чрез промивки с висока концентрация на сол позволява контролирано и прецизно елуиране на вируса във фракции, които могат да бъдат допълнително концентрирани. Само концентрирането на определени фракции от елуирания вирус допълнително премахва потенциалните замърсители, като същевременно се възстановяват >97% от елуирания вирус. Едно ограничение на пречистването с афинитетна хроматография с хепарин сефароза е, че не прави разлика между празни и пълни частици. Ще трябва да се включат допълнителни етапи на аналитично ултрацентрофугиране, за да се отстранят празните капсиди 31 .

                            qPCR е рентабилен и бърз метод за определяне на броя на векторните геноми в AAV векторна подготовка. Въпреки че qPCR е чувствителен метод за количествено определяне, той не предоставя никаква информация за броя на инфекциозните частици в препарата. Освен това чувствителността на този анализ може да доведе до променливост, тъй като техническите грешки по време на пипетиране могат да доведат до вариабилност между анализите. По този начин, за всеки експеримент, който включва сравняване на различни AAV вектори, е изключително важно векторите да бъдат титрирани върху една и съща qPCR плака. Въпреки тези ограничения, qPCR е най-точният метод, разработен за титриране на AAV и в момента е най-широко използваният и приет метод за количествено определяне на AAV вектори 32 . Използването на праймер/сонда, която се свързва към SV40 polyA на генома на rAAV, се основава на факта, че тази последователност е запазена в много AAV геномни плазмиди, конструирани в лаборатория. Освен избора на запазена последователност сред плазмидите на rAAV генома на читателя, qPCR сондите могат да бъдат проектирани за всички части на генома на rAAV, включително, но не само, промотори, трансгени или пост-транскрипционни фактори.

                            Оценяването на чистотата и качеството на AAV продукта е важна стъпка в производствения процес. Western blotting може да се използва за откриване на VP1, VP2 и VP3 структурни протеини, които съставляват капсида на AAV, както и всякакви променени форми на VP. VP1, VP2 и VP3 обикновено присъстват в съотношение 1:1:10, но това може да варира от 1:1:5 до 1:1:20 в зависимост от серотипа. Следователно е от решаващо значение да се определи съотношението за всяка система емпирично, особено защото е доказано, че N-терминалната област на VP1 е важна за инфекциозността и трансдукцията 33 . SDS-PAGE, съчетан с оцветяване с Coomassie, е доста лесен метод за откриване на VP1, VP2 и VP3, както и замърсители на протеини на клетката гостоприемник. Използването на флуоресцентни протеинови оцветители като SYPRO Ruby предлага по-висока чувствителност при откриване на протеинови замърсители на клетката гостоприемник от Coomassie, но не всички лаборатории имат достъп до оборудването за изображения, необходимо за визуализиране на гела. И накрая, търговските ELISA могат да бъдат използвани за количествено определяне на протеинови замърсители на клетката гостоприемник в AAV вектори, произведени в клетки HEK293.

                            Този протокол предоставя задълбочен преглед на производството на rAAV с висок титър и висока чистота за серотипове, които се свързват с хепарин. В раздела с представителни резултати, използването на нов AAV6.2FF, експресиращ hIgG в различни животински модели, показва безопасността и ефективността на този rAAV in vivo. Въпреки че векторът AAV6.2FF беше администриран IM, тези висококачествени вируси с висока чистота могат да се прилагат по различни начини in vivo, като възможни възпалителни замърсители, като протеин на клетката гостоприемник, са елиминирани чрез нашите процеси на пречистване.

                            Изисква се абонамент. Моля, препоръчайте JoVE на вашия библиотекар.

                            Разкрития

                            Сара К. Уутън е изобретател на американски патент US10806802B2 за капсида AAV6.2FF.

                            Признания

                            Амира Д. Ргеи, Брена А. Ю. Стивънс, Силвия П. Томас и Джейкъб Г. Е. Йейтс бяха носители на студентски стипендии от ветеринарния колеж в Онтарио, както и на стипендии за завършване на Онтарио. Amira D. Rghei беше носител на Mitacs Accelerate Studentship. Тази работа беше финансирана от грант за проект на Канадските институти за здравни изследвания (CIHR) (#66009) и грант за съвместни проекти за здравни изследвания (партньор с NSERC) (#433339) на SKW.


                            Емисиите на CO2 Държава (тона въглероден диоксид) 2012 населението  емисии на глава от населението  Китай 8782000000 1359750000    САЩ 5,144,000,000 316597000   Индия 2185000000 1233460000  Русия  1646000000

                            Група учени изследвали ефекта на химикал върху различни щамове бактерии. Щам А започва с 6000 клетки и намалява с постоянна скорост от 2000 клетки на час след прилагане на химикала. Щам B започва с 2000 клетки и намалява


                            Онколитичните вируси като инженерни платформи за комбинирана имунотерапия

                            За ефективно надграждане върху последните успехи на блокадата на имунната контролна точка, приемната Т-клетъчна терапия и раковите ваксини, е от решаващо значение да се разработят рационално комбинирани стратегии, които ще увеличат и разширят ефикасността до по-голяма част от пациентите. Например, комбинацията от анти-цитотоксичен Т-лимфоцит-асоцииран антиген 4 (CTLA4) и анти-програмиран протеин на клетъчна смърт 1 (PD1) инхибитори на имунната контролна точка по същество удвоява степента на отговор при някои пациенти с метастатичен меланом. Въпреки това, като се има предвид хетерогенността на рака, изглежда вероятно да са необходими дори по-сложни комбинации от имуномодулиращи агенти за получаване на последователни, трайни терапевтични отговори срещу широк спектър от ракови заболявания. Това носи сериозни последици по отношение на токсичността за пациентите, осъществимостта за доставчиците на грижи и разходите за системите за здравеопазване. Завладяващо решение се предлага от онколитичните вируси (OVs), които могат да бъдат проектирани да се възпроизвеждат селективно и да унищожават туморната тъкан, като същевременно повишават антитуморния имунитет. В тази статия от становището ние твърдим, че бъдещето на имунотерапията ще включва OVs, които функционират като мултиплексирани имуномодулиращи платформи, експресиращи фактори като инхибитори на имунната контролна точка, туморни антигени, цитокини и Т-клетъчни активатори. Ние илюстрираме тази концепция, като следваме опитите и трудностите на тумор-реактивните Т-клетки от първоначалното им праймиране до изпълнението на цитотоксична ефекторна функция в туморното легло. Ние подчертаваме безбройните възможности за OVs да помогнат за преодоляване на критичните бариери в пътуването на Т-клетките, което води до нови синергични механизми в битката срещу рака.


                            Вектори

                            Представени са също рекомбинантни вектори, включващи всеки един или повече от полинуклеотидите, описани по-горе. Вектор, описан тук, може да се използва във връзка с един или повече други вектори (например, 1, 2, 3 или повече вектори), описани тук като векторна система, която може да се използва за генериране на рекомбинантни репликационни дефектни RhAds (rdsRhAds) или репликационно-компетентни RhAds (rcsRhAds), описани тук. Съответно са представени аденовирусни векторни системи за всеки от четиринадесетте аденовируса (RhAd54-RhAd67), описани тук. Такава векторна система може да се използва за генериране на репликационно-дефектни аденовируси съгласно методи, известни в областта, които са били приложени за генериране на партиди без аденовирус, компетентни за репликация, базирани на, например, Ad5, Ad11, Ad35 и Ad49 (виж, напр. , WO 97/00326, WO 00/70071 WO 02/40665 US Pub. No. 2005/0232900, всички включени тук чрез препратка).

                            Описаните тук вектори могат да съдържат Е1 региона (например, последователност, имаща поне 90% идентичност на последователността с Е1 регион, дефиниран в Таблица 3) за целите на производството на rcsRhAds.

                            Описаните тук вектори могат да съдържат левите RhAd последователности и експресионна/трансгенна касета. Експресионната касета на вектора може да замести или разруши цялата или част от Е1 областта на аденовируса. Експресионната касета може да включва, например, промотор (например, CMV промотор, например CMVlong промотор), който стимулира експресията на трансген, и по избор, полиаденилационен сигнал (например, хетероложна нуклеотидна последователност, кодираща антигенен ген продукт от интерес, например бактериален, вирусен, паразитен, гъбичен или терапевтичен протеин, или негов фрагмент). Е1 участъкът (например, последователност, имаща поне 90% идентичност на последователността с Е1 регион, дефинирана в Таблица 3) може да бъде изтрита (частично или напълно), нарушена или направена неактивна от една или повече мутации. Такива вектори са илюстрирани, например, в празните вектори, описани тук (вижте, например, фиг. 8, 10, 12, 13, 17, 19, 20, 23, 24, 27, 29, 31, 33, 35, 37 , 39, 40 и 44, които изобразяват празните вектори, съответстващи на SEQ ID NOs: 224, 226, 228, 229, 234, 236, 237, 240, 241, 244, 246, 248, 052, 252 , 257 и 262, на които липсва Е1 областта за всеки от RhAd54-RhAd67).

                            Описаните тук вектори могат да съдържат лявата част от последователностите RhAd (например, лявата част на която и да е от RhAd54-RhAd67), която включва пентонната база и 52K кодиращи области на RhAd, и/или дясната част на RhAd последователности (например, дясната част на която и да е от генома RhAd54-RhAd67 от приблизително pVII до десния ITR (rITR)). Описаните тук вектори могат да съдържат лявата част от RhAd последователности (например, лявата част на която и да е от RhAd54-RhAd67), която включва pIX и pIVa2 кодиращи региони на RhAd, и/или дясната част на RhAd последователности (например, дясната част на който и да е от генома RhAd54-RhAd67 от приблизително pIX до rITR).

                            Описаните тук вектори могат да имат изтрит, нарушен или мутирал Е3 (dE3) (например, последователност, която има поне 90% идентичност на последователността с Е3 регион, дефиниран в Таблица 3) и/или Е4 (dE4) регион (напр. последователност, имаща поне 90% идентичност на последователността с Е4 регион, дефиниран в Таблица 3), което не е необходимо за репликация и пакетиране на аденовирусната частица. Например, цялата или част от региона Е3 и/или Е4 може да бъде изтрита. Такива вектори са илюстрирани, например, в pWe/RhAd.pIX-rITR векторите, описани тук (вижте, например, Фигури 9, 11, 13-16, 18, 21, 22, 25, 26, 28, 30, 32 , 34, 36, 38, 41-43 и 45, които изобразяват вектори, съответстващи на SEQ ID NOs: 225, 227, 230-233 234, 235, 238, 239, 242, 243, 245, 24, 24 253, 255, 258-261 и 263, при които липсва Е3 областта за всеки от RhAd54-RhAd67).

                            Изтриването на Е3 областта обикновено се предпочита, ако големи трансгенни последователности (например, последователност на нуклеинова киселина, кодираща хетероложен полипептид (например, антиген от инфекциозен агент или рак), както е описано тук), трябва да бъдат включени във вектора, тъй като геномът размерът, който може да бъде пакетиран във функционална частица, е ограничен до приблизително 105% от размера на дивия тип. Трябва да се разбере, че други модификации могат да бъдат въведени в аденовирусния геном, като делеция на Е2А областта.

                            Клетка, трансфектирана с вектор, описан тук, може да допълни тези недостатъци чрез предоставяне на функционалността на липсващия(ите) регион(и). Регионът E2A може да бъде осигурен, например, от чувствителен към температура E2A мутант или чрез предоставяне на E4 функции. Клетките, които могат да бъдат използвани за допълване на дефицит на аденовирусен ген (например делеция на Е1, Е3 и/или Е4) на вектор, описан тук, включват, например, 293 клетки или други Е1 допълващи клетки.

                            Резус аденовирусни вектори от изобретението могат ефективно да се образуват при трансфектиране на Ad векторни конструкции в съществуваща Е1-комплементираща клетъчна линия, допълнително експресираща 55k протеин (напр. 55k протеин на човешки Ad серотип 5 и 35, резус Ad серотип 52 (виж, например GenBank номер за достъп AIY35078) и 59, или други известни рекламни серотипове). 55k може да бъде предоставен на клетките за получаване на заявените вирусни вектори чрез ко-експресия в клетките (например, чрез ко-трансфекция в клетките или чрез интеграция на клетка-гостоприемник). Ко-експресията на 55k насърчава ефективната рекомбинация на ДНК и следователно образуването на рекомбинантен вирус върху съществуващи Е1-комплементиращи клетъчни линии.

                            RhAd52 55k протеинът има следната последователност:

                            Много вирусни векторни експресионни системи са известни в областта и модификациите на аденовирусните геноми са в обхвата на настоящото изобретение, което по принцип се отнася до четиринадесетте RhAds, описани тук (RhAd54-RhAd67), техните геномни последователности или части от тях, техни варианти и използването им. Както е описано по-горе, всеки един вектор, описан тук, може да бъде използван във връзка с един или повече други вектори, описани тук. В някои изпълнения се използват вектори, които кодират както лявата, така и дясната страна на генома на RhAd, за да се генерира даден RhAd, описан тук.

                            Представени са също вектори за генериране на химерни аденовируси, които включват част от един или повече от RhAd54-RhAd67геномите, както и част от генома на един или повече други вируси. Химерните аденовирусни вектори могат да включват заместване на целия или част от, например, хексона и/или влакнестия протеин на RhAd54-RhAd67. Например, част или целият хексонов протеин на RhAd54-RhAd67 може да бъде заместен с този на друг вирус (например, един или повече от хексонов протеин хиперпроменливи региони (HVRs) на RhAd54-RhAd67 (например, HVR, очертан в табл. 2 на хексонов протеин на който и да е от RhAd54-RhAd67).

                            Частта или целият фибрилен протеин на RhAd54-RhAd67 може да бъде заменен с този на друг вирус. Например, домейнът на влакното копче на RhAd54-RhAd67 може да бъде заместен. Заместените региони могат да бъдат заменени с регион, получен от аденовирус, който има по-ниска серопревалентност в сравнение с тази на Ad5, като подгрупа B (Ad11, Ad34, Ad35 и Ad50) и подгрупа D (Ad15, Ad24, Ad26, Ad48, и Ad49) аденовируси, както и маймунски аденовируси (напр. Pan9, известен също като AdC68). Аденовирусен векторен гръбнак от Ad5, Ad11, Ad15, Ad24, Ad26, Ad34, Ad48, Ad49, Ad50 или Pan9/AdC68 може също да се използва за получаване на вектор, който включва заместване на всички или на част от един или повече от над хексон HVRs на RhAd54-RhAd67.


                            Повече информация

                            Политика за интернет сигурност

                            Използвайки този сайт, вие се съгласявате с наблюдение и одит на сигурността. За целите на сигурността и за да се гарантира, че обществената услуга остава достъпна за потребителите, тази правителствена компютърна система използва програми за наблюдение на мрежовия трафик, за да идентифицира неоторизирани опити за качване или промяна на информация или за причиняване на по друг начин щети, включително опити за отказ на услуга на потребителите.

                            Неоторизирани опити за качване на информация и/или промяна на информация в която и да е част от този сайт са строго забранени и подлежат на наказателно преследване съгласно Закона за компютърни измами и злоупотреби от 1986 г. и Закона за защита на националната информационна инфраструктура от 1996 г. (вижте дял 18 USC §§ 1001 и 1030).

                            За да гарантира, че нашият уебсайт работи добре за всички потребители, SEC следи честотата на заявките за съдържание на SEC.gov, за да гарантира, че автоматизираните търсения не оказват влияние върху възможността на другите да имат достъп до съдържанието на SEC.gov. Запазваме си правото да блокираме IP адреси, които подават прекомерни заявки. Настоящите насоки ограничават потребителите до общо не повече от 10 заявки в секунда, независимо от броя на машините, използвани за подаване на заявки.

                            Ако потребител или приложение подаде повече от 10 заявки в секунда, допълнителни заявки от IP адреса(ите) може да бъдат ограничени за кратък период от време. След като процентът на заявките падне под прага за 10 минути, потребителят може да възобнови достъпа до съдържание на SEC.gov. Тази практика на SEC е предназначена да ограничи прекомерните автоматизирани търсения в SEC.gov и не е предназначена или очаква да повлияе на лица, които разглеждат уебсайта SEC.gov.

                            Имайте предвид, че тази политика може да се промени, тъй като SEC управлява SEC.gov, за да гарантира, че уебсайтът работи ефективно и остава достъпен за всички потребители.

                            Забележка: Ние не предлагаме техническа поддръжка за разработване или отстраняване на грешки в скриптирани процеси за изтегляне.



Коментари:

  1. Tooantuh

    Вие сте ударили мястото. Мисля, че това е много страхотна идея. Напълно съм съгласен с теб.

  2. Dijinn

    Мисля, че е - вашата грешка.

  3. Dakotah

    Абсолютно съгласен с теб. I think it's a good idea.



Напишете съобщение